... FTP : HEASARC LEGACY data . ARIEL-5 All-Sky Monitor (ASM) Lightcurves Database . X-ray and optical light-curves of XNs at HEASARC LEGACY . Collected X-ray and optical light-curves of A 0620-00 and GS 1124-683 . ... About FITS format FITS resources from HEASARC . Related Astrophysics Sites . ... Cambridge University Press Handbook of Space Astronomy and Astrophysics . Neutron Stars and Black Holes in X-Ray Binaries Jan van Paradijs . ... Catalogue of Low-Mass X-Ray Binaries . ...

Еще в разделе: (Показать все результаты (>517) - xray.sai.msu.ru/ )

• Be/X-ray binaries and candidates
• Discussion
• State of the problem

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... Scientific payload of the ?Lomonosov? satellite will include a complex of the devices ELFIN-L and DEPRON for the studies of the processes of the charged particles penetration into the upper atmosphere of the Earth and for the analysis of the radiaiton conditions at low altitudes. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• IMISS-1 | Университетский спутник "Ломоносов"
• Transient luminous events | Университетский спутник "Ломоносов"
• Cosmic rays of extremely high energy | Университетский спутник "Ломоносов"

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>236) - herba.msu.ru/ )

• Our aim was to investigate the influence of weather conditions and prey on the
• Moscow State University, Geobotany dpt. - View Staff

. Parent Directory . 00-index . bullet25.zip . cslio205.zip . db02.zip . dbf2msql-2.0.zip . dbf2mysql-1.10d.zip . dbf_edit1_0.zip . dbffg04b.zip . dbfin096.zip . dbi-1_02.zip . dbv05.zip . mbase205.zip . msql-bench.zip . msql-mysql-modules-1_2010.zip . msql207b1.zip . mysql-c.zip . mysql-client-3.22.26a.zip . mysql2-3.22.26a.zip . odb.zip . os2mb106.zip . postgres652.zip . postgres7.0.0-server-bin_os2.zip . viper092.zip . www-mysql-0.5.7.zip . xdbfj19a.zip

Еще в разделе: (Показать все результаты (>1484) - crydee.sai.msu.ru/ )

• Work notes
• Equation of state for solar modeling

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>13269) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-ruby/database_cleaner/
• Index of /pub/gentoo-portage/dev-python/dj-database-url/
• Index of /pub/gentoo-portage/dev-util/monodevelop-database/

International Laser Center of MSU . ... Home Science and education Scientific Laboratories Laboratory of solid-state lasers and coherent spectroscopy . ... The first experiments in the laboratory of solid-state lasers and coherent spectroscopy were done in 1974-1975 years. ... In 1980, the laboratory began more complex experiments on the base of picosecond lasers, namely experiments realizing nonstationary picosecond CARS of molecular gases (CARS-coherent antiStokes Raman scattering). ...

Еще в разделе: (Показать все результаты (>78) - ilc.phys.msu.ru/ )

Evaluation framework for the taxonomic classification of metagenomic sequences Dmitrij Turaev, Michael Sommer, Thomas Rattei Department of Computational Systems Biology, University of Vienna, Althanstraъe 14, 1090 Vienna, Austria; dmitrij.turaev@univie.ac.at Metagenomics offers access to microbial communities, which are difficult or impossible to study under laboratory conditions [1]. ... The lengths of resulting sequence reads range between less than hundred and around thousand nucleotides. ...

Еще в разделе: (Показать все результаты (>255) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/120.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/45.pdf

... The influence of the crystallization conditions and postcrystallization processes on the real structure of PbTe-based semiconductor solid solutions was studied. ... The postcrystallization processes were studied on PbTe crystals doped with Cr, Co, Ni, and In, which were grown at different supersaturations and had different real structure. ... The real structure of samples with low impurity concentration and dislocation density of (1-2)*10^4$~cm$^{-2}$ exhibits minimal changes during the annealing. ...

Еще в разделе: (Показать все результаты (>1211) - chem.msu.ru/ )

• PC Crystal Chemistry Analysis of Organic Crystal Structures
• Thermodynamic calculation of yttrium-barium-copper-oxygen phase diagram
• Ion-Exchange Properties of Glutamic Acid-Bonded Silica

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development (Archive) . ... Java Swing, Database . ...

Еще в разделе: (Показать все результаты (>489) - www.snto-msu.net/ )

• Embedded firebird database - вопрос по скорости - Public forum of MSU united
• Во всех разделах перед списком постов такая фигня: - Public forum of MSU united
• mssql, заресторить базу из файла бэкапа - Public forum of MSU united student

.

Еще в разделе: (Показать все результаты (>58) - www.chemport.ru/ )

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>52) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/pose/talk.doc
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>4) - vernov-relec.sinp.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>7) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>136) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ
• E. Katkova Docking and postprocessing: application to design of urokinase
• Laboratory of Informatics

Heating Process Simulation for a Body Subjected to an Intensive Thermal Effect on Its Surface / Yumashev M.V., Yumasheva M.A., Krasnova P.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>230) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2012

The biotic conception of aquatic ecosystem control . ... Ecological standartization. ... The biotic conception of aquatic ecosystem control rests on . ... kind for decades with natural objects at locations of human resi- . ... nition in the multidimensional space of ecological factors aimed . ... en named the ecologically tolerable levels (the ETL) of distur- . ... tic conception, makes it possible to solve the ecological control . ... To realize the biotic conception of ecological control it is . ...

Еще в разделе: (Показать все результаты (>517) - chronos.msu.ru/ )

• Determination analysis as a method for diagnostics of ecosystem condition

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>5696) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• allpy: 1fb830d7517e Makefile

... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute ­ solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/malev.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

... Sur le CEI . ... Condition d??tudes . ... Frais de scolarit? TUITION FEES . ... Full-Time Tuition - 2 6 academic hours per week : . ... Part-Time Tuition - 18 academic hours per week : . ... If paid in several installments, course fees are calculated at the rate of US $ 150 per week for full-time tuition and US $ 120 per week for part-time tuition. ... 1 Full-Time Tuition (24 academic hours per week) US $ 1 95 per week . ... Part-Time Tuition (20 academic hours per week) US $ 1 70 per week . ...

Еще в разделе: (Показать все результаты (>255) - www.cie.ru/ )

• Condition d??tudes :: CEI
• Inscription :: Condition d??tudes :: CEI
• Logement :: Condition d??tudes :: CEI