... WN_LIST=/ opt / glite / yaim /etc/wn-list.conf USERS_CONF=/ opt / glite / yaim /etc/users.conf GROUPS_CONF=/ opt / glite / yaim /etc/groups.conf FUNCTIONS_DIR=/ opt / glite / yaim /functions OUTPUT_STORAGE=/tmp/jobOutput # Set this to your prefered and firewall allowed port range GLOBUS_TCP_PORT_RANGE= 20000,25000 PX_HOST=lcg14.sinp.msu.ru BDII_HOST=lcg-bdii. cern .ch MON_HOST=my-mon. cern .ch REG_HOST=my-reg ...

Еще в разделе: (Показать все результаты (>11) - lhe.sinp.msu.ru/ )

• Brief CompHep Installation Instruction

08-Dec-2006 08:17:57] PHP Warning: Invalid argument supplied for foreach() in / home / plogisti / public_html / modules / ax_visitors / atomax /edit_attr. php on line 289 [13-Dec-2006 05:12:41] PHP Parse error: syntax error, unexpected T_CONSTANT_ENCAPSED_STRING, expecting ']' in / home / plogisti / public_html / modules / ax_visitors / atomax /action_visitor. php on ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Edge Detection Using Reaction-Diffusion Equation with Variable Diffusion Coefficient . ...

Еще в разделе: (Показать все результаты (>189) - graphics.cs.msu.ru/ )

... We study the effect of high-temperature annealing on the conductivity temperature dependence of a-Si:H films. Two types of films were studied: uniform and nanolayered prepared by cyclic repetition of CVD and hydrogen plasma treatment. It is shown that for annealing temperatures above 450C, the low-temperature conductivity obeys the law ln(sigma) = const - (T 0 /T) n , where the exponent is n = 1/2 for uniform and n = 1/3 for layered films. ...

Еще в разделе: (Показать все результаты (>56) - scon155.phys.msu.su/ )

• X-ray diffraction investigations of phase transitions in narrow-gap IV-VI

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>20) - comphep.sinp.msu.ru/ )

Moss D., Sokoloff D., Resonances for activity waves in spherical mean field dynamos, eprint arXiv:1211.2414, 6 pages, 6 figures, 2012. We study activity waves of the kind that determine cyclic magnetic activity of various stars, including the Sun, as a more general physical rather than a purely astronomical problem. We try to identify resonances which are expected to occur when a mean-field dynamo excites waves of quasi-stationary magnetic field in two distinct spherical layers. ...

Еще в разделе: (Показать все результаты (>71) - srcc.msu.ru/ )

• D.Moss, D.Sokoloff, Seed fields for galactic dynamos, Astron. Astrophys.

Application of a control-volume method for solving the problems of two-phase filtration in "speed-saturation" variables" . Nikiforov G.A. An approach to solving the problems of motion of a two-phase liquid in porous media is considered in the framework of a control-volume method. A mathematical formulation of such a problem and an algorithm of its numerical implementation in "speed-saturation" variables are discussed. ... PostScript (in Russian) (5.30MB) . PDF (in Russian) (468KB) . ...

Еще в разделе: (Показать все результаты (>200) - num-meth.srcc.msu.ru/ )

• A variable structure algorithm using the (3,2)-scheme and the Fehlberg method
• A hybrid heuristic parallel method of global optimization
• "Construction of isoline maps of functions of two variables"

... OPERA main features: 1) long baseline, 2) high neutrino energy, 3) Kton detector mass , 5) detect short lived taus produced in tau neutrino interactions L = 730 km CERN T flight = 2. 44 m s LNGS Expected neutrino interactions for 22.5x1019 pot: ~ 23600 µ CC + NC ~ 160 e + e CC ~ 115 CC (m2 = 2.5 x 10-3 eV2) 2 CNGS neutrino beam performances 2006 2007 2008 2009 2010 0.076x1019 pot 0.082x1019 pot 1.78x1019 pot 3.52x1019 pot 1.74x1019 pot (19 July) Commissioning ...

Еще в разделе: (Показать все результаты (>159) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/rep_M_QFTHEP.pdf
• http://qfthep.sinp.msu.ru/talks2015/QFTHEP15_Vorotnikov_v9.pdf
• http://qfthep.sinp.msu.ru/talks2015/QFTHEP%20-%20Myagkov.pdf

... Assessment of water quality under changing climate conditions . ... Scope: Climate change coupled with geographically heterogeneous population growth, land use change, increasing urbanization, and changing water use are expected to have major effects on water supply and water quality. ... Climate change effects on streamflow, timing of snowmelt, timing and magnitude of groundwater recharge, ecosystem responses, and impacts of changing land cover and land use are likely to affect water quality. ...

Еще в разделе: (Показать все результаты (>22) - eng.geogr.msu.ru/ )

This page is devoted to information on Supernova 1999dq in NGC 976 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main supernova page. Information on the original web pages for many of these images can be found on the Supernova links web page. Supernova 1999dq is the 24th LOSS discovery this year. ... VSNET Light curve (requires JAVA). ... vsnet-alert 3442 ] SNe 1999dp and 1999dq . vsnet-chat 2285 ] Host galaxy of SN1999dq . ...

Еще в разделе: (Показать все результаты (>41) - www.rochesterastronomy.org/ )

• Supernova 1999ee and 1999ex in IC 5179
• Supernova 1999ev in NGC 4274
• Supernova 1999ej in NGC 495

The conference will take place at the Mathematical Research and Conference Center in Bedlewo , near Poznan. You can easily get to Poznan by train from Warsaw or Berlin. The participants are expected to arrive to Bedlewo on January 25. There will be reserved a bus from the Poznan train station "Poznan Glowny" to Bedlewo. Please wait for the bus in front of the main entrance of the station. The bus departure is expected to be at 7:00 p.m. There is also a small airport in Poznan. ...

Еще в разделе: (Показать все результаты (>126) - higeom.math.msu.su/ )

• C*-algebras: Arrival

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>16) - mouse.belozersky.msu.ru/ )

• Geometrical core
• Example of alignment

. EVENTS . Russian version . Laboratory of Associating Polymers and Colloids . NEWS . HOME . Home . RESEARCH . Research interests . Objects . Methods . Applications . EDUCATION . Education . RESEARCH GROUP . Staff . PhD students . Undergraduate students . ALUMNI . Former staff . Former PhD students . Former undergraduate students . PROJECTS . Projects . PUBLICATIONS . Selected papers . Patents . Reviews . COLLABORATION . Collaboration . VIRTUAL TOUR . Virtual tour of the lab . CONTACTS . Contacts . WELCOME!

Еще в разделе: (Показать все результаты (>96) - polly.phys.msu.ru/ )

• site Carousel With Variable Elements Widths | Lemmon jQuery
• NATO Scientific & Environmental Affairs
• NATO Scientific Environmental Affairs

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• ConClus
• Align tool for DNA-protein complexes

... Полная версия этой страницы: EXPECT . Студенческий форум Физфака МГУ > Общий > Все обо всем > Цифровые технологии . GLAMURRRRRR . ... есть таккая штука под UNIX называица expeсt...па нему нету вроди как книжек нарускам..вот..может кто подскажет как мона ево асвоить..нада по работе. ivandasch . ... чето такое помню, што пользовался для чего-то им, но не помню... =( врде как автоматизация в шелле работы с телнет и всякими прогами типа консолных... но мож ошибаюсь, знакомо вобщем. man expect . ...

Еще в разделе: (Показать все результаты (>733) - wasp.phys.msu.ru/ )

• EXPECT - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > PhD in Astrophysical Sciences, Princeton, USA
• Студенческий форум Физфака МГУ > ZFC IS INCONSISTENT.

... Invariant Equations for (1+1) Linear Parabolic Equations . ... Semi-invariants for linear parabolic equations in two independent variables and one dependent variable under linear changes of the dependent variable have been investigated in [1]. The joint invariant equation for   (1+1) linear parabolic equations for reduction to the classical heat equation has also been deduced in [2]. We further study reduction for these type of equations   under equivalence transformations. ...

Еще в разделе: (Показать все результаты (>126) - acs366.phys.msu.su/ )

• Abstract (Invited)

Composition of an Efficient Portfolio in the Bielecki and Pliska Market Model / Kambarbaeva G.S. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>105) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2010

Franco Peracchi IV and GMM under weak instruments Spring 2011 Course outline 1. The instrumental variables (IV) method · · · · · · · · · · · · · · · · · · · · · · · · · · · · Inconsistency of OLS The simple IV estimator The class of IV estimators Sampling properties Estimates of statistical precision Hypothesis testing 2SLS Motivating examples Definitions and basic models The bias of 2SLS Standard asymptotic approximations Alternative asymptotic approximations Detecting weak ...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>4427) - www.mgubs.ru/ )

• Высшее образование | Высшая школа бизнеса МГУ им. Ломоносова
• Высшая школа бизнеса МГУ им. Ломоносова

... Nor can the idea of intercultural communication be limited (as it was ? ... The department for discourse and communication studies in the School of Philology of Moscow Lomonosov University strives to provide for advanced level of verbal and visual (media) literacy, enabling students to combine critical and creative objectives, develop sophisticated analytical perspectives on the intersections of media, culture, translation, speech communication practices and social analysis. ... Mass culture ? ...

Еще в разделе: (Показать все результаты (>239) - www.philol.msu.ru/ )

• LangueDOC :: Tools :: Text conversions