... О UNИX . ... ACL processing . ... read - users will be able to read a page, and download its attachments. write - users will be able to edit (write) a page, and upload attachments. delete - users will be able to delete a page and it's attachments. revert - users will be able to 'revert' a page back to an older revision. admin - users will be able to change the "#acl" line on a page, as well as grant and/or revoke "admin" privileges from others. ... ACL used if no ACL is specified on the page . ...
... Apache HTTP Server Version 2.0 . ... A single control process launches the number of child processes indicated by the NumServers directive at server startup. ... For each child process, Apache assesses the number of idle threads and creates or destroys threads to keep this number within the boundaries specified by MinSpareThreads and MaxSpareThreads . ... The User and Group directives are used to set the privileges of the Apache child processes. ... Maximum number of threads per child process . ...
... What distinguishes Armenian from most other Indo-European languages is the unusually high proportion of early lexical borrowings. ... The first case is that of Urartean, a non-Indo-European language spoken during the first millennium BC in the mountains of Eastern Anatolia, roughly in the same area where Armenians lived up to 1915. ... The second one is the case of Parthian, an Indo-European Iranian language that was spoken in Northern Iran from around 300 BC to 300 AD. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Armenian1.pdf -- 124.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/Armenian1.pdf -- 124.0 Кб -- 30.04.2010 Похожие документы
Psychology in Russia: State of the Art · 2009 Motivation of professional creative thinking Mergals M. Kashapov, Anna V. Leybina Yaroslavl State Demidov University Yaroslavl The aim of this study was to reveal correlation between motivation and creative professional thinking. ... Prosperity factor is obviously correlated with creative factor in the motivation system of workers with oversituational level of professional thin king, because it provides comfort to them. ... Motivation and Emotion, 5. ...
... The exercises cover the following areas: Session A covers three ways you can use ROOT: the command line, the script processor, and the graphical user interface (GUI). ... Session A: | ... Display |cern.ch/root/Atlfast.html| ... Use the ROOT command line . ... In a new session open the new ROOT file (altfast.root) and find the TFile method to print the compression factor: root[] TFile f("atlfast.root") root[] f.<TAB> 3: What is the size and compression factor of the generated file, atlfast.root? ...
[
Текст
]
Ссылки http://acat02.sinp.msu.ru/presentations/brun/Exercises_2.doc -- 106.5 Кб -- 06.07.2002 Похожие документы
... Geography of World Economy . ... This led to the need to study the spatial organization of the world economy, geopolitics, the geography of international economic relations, regional integration of states and other relevant topics. ... Elena N. Samburova, PhD (Geography): geographical Sinology; the geography of international economic relations; position of Russia in the world economy; . ... Introduction into the Geography of World Economy: International Division of Labor (in Russian) . ...
Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...
This module provides for determining the types of files from the filename and for association of handlers with files. ... The directives AddCharset , AddEncoding , AddHandler , AddLanguage and AddType are all used to map file extensions onto the meta-information for that file. ... Files> . ... For example, if you had a directory you wanted to be parsed entirely as imagemap rule files, regardless of extension, you might put the following into an .htaccess file in that directory: SetHandler imap-file . ...
... Okhapina, E. Y. The Boundary Zones of the Eastern Urals . Natural restrictions of the East Uralian structures are two intensive deformed boundary zones, which are the Sheludivy Gory Boundary Zone (SGBZ) in the west and the Redutovo Boundary Zone (RBZ) in the east. SGBZ represents a package lens-shaped and steeply dipping faulted blocks, horizontal dimension of which usually does not exceed 2 km. ... Deformation degree in this boundary zone are significantly higher than in the former. ...
... Sheet dike complex of the forearc ophiolite . ... Dike series serve the joining of a heterogenous ophiolite complexes . They are presented link packets and swarms of dikes and semidikes and locally single dikes of diabase and gabbro-diabase. ... The interrelations between the dike complex and the rest of the members of ophiolite association do not suggest significant horizontal movements of ophiolite before semidikes packets intrusion. ... Semidike rocks of the former . ...
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Study of single top quark production with the CMS detector Natalia Tsirova D.V. Skobeltsyn Institute of Nuclear Physics, Moscow State University for the CMS collaboration QFTHEP 2013 25 June Outline Single top processes and motivation t-channel measurements Cross section Charge asymmetry Associated tW production Summary 2 Single top Single top quark analysis) t-channel cross section (7 TeV) | analysis: likelihood fit to | ...
[
Текст
]
Ссылки http://qfthep.sinp.msu.ru/talks2013/tsirova_qfthep_2013-06-25.pdf -- 1180.3 Кб -- 25.06.2013 Похожие документы
... 1, 64295 Darmstadt, Germany, 004906159712545, s.sommer@gsi.de Multicolor in situ hybridization (m-FISH) and Spectral Karyotyping (SKY) are molecular cytogenetic techniques that permit the simultaneous visualization of all human (or mouse) chromosomes in different colours (chromosome painting), facilitating a detailed karyotype analysis. ... In the present talk new insights into the induction of aberrations by high + low LET radiation, analysed by m-FISH will be discussed. ...
Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . ... Deprecated : Non-static method JFactory::getConfig() should not be called statically, assuming $this from incompatible context in /wcmc/ms/ms/libraries/joomla/application/application.php on line 726 . ...
... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... РЖ "Geography, Environment, Sustainability" . ... Учебно-методический отдел . ... Кафедра географии мирового хозяйства . Кафедра геохимии ландшафтов и географии почв . ... Diversity of hydrochemical parameters of surface waters was revealed relative to the catenary organization of elementary water catchments in the middle taiga subzone. ... Levels of the international movement of capital: geographical interpretation . ...
... Это согласуется с данными, полученными Schaad [2], нашедшим у детей, получавших 3 месяца ЦФЛ, утолщение хряща без кaкиx-либo его пoвpeждeний. ... Во-вторых, это своеобразная защищенность триединой системы коленного сустава у человека: синовиальная оболочка - синовиальная жидкость (синовия) - хрящ. ... Например, покровные клетки синовиальной оболочки способны к активному фаго- и пиноцитозу железа, при этом оно не обнаруживается в клетках или матриксе хряща. ...
... After defining such concepts as the adaptive system, reflection, the sign, meaning, sense, identification and recognition, it is easy to develop our ideas on the nature of modelling , whose role is in general becoming constantly more important in scientific work, and this is especially true in cybernetics. ... Language to describe senses. ... Shall we obtain a correct reflection of a text's sense structure if we transfer all the linguistic units of a natural text into "senses language". ...
... История медицинского образования в МГУ . ... ;legends of cardiology and leading cardiologists on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of...
Подписка на рассылку обзоров astro-ph на Subscribe.Ru . ... Обзоры УФН . ... Обзоры препринтов astro-ph . ... Comments: Proceedings of lectures given at the XXIIIrd Canary Islands Winter School; 71 pages; to appear in Secular Evolution of Galaxies, eds. J. Falc\'on-Barroso & J. H. Knapen (Cambridge: Cambridge University Press), in press. ... Comments: 8 pages, 11 figures, Proceedings for the XXV International Conference on Neutrino Physics and Astrophysics (Neutrino 2012), June 2012, Kyoto, Japan . ...