... Башкирский государственный университет, физико-технический институт . ... ВОРОНЕЖСКАЯ ГОСУДАРСТВЕННАЯ ЛЕСОТЕХНИЧЕСКАЯ АКАДЕМИЯ . ... ИБХФ РАН . ... Московская Академия Водного Транспорта . ... МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМ. М.В.ЛОМОНОСОВА, Биологический ф-т, каф. биофизики . ... МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМ. М.В.ЛОМОНОСОВА, Физический ф-т, каф. общей физики и волновых процессов . МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМ. М.В.ЛОМОНОСОВА, Химический ф-т . ...
Инструкция по заполнению анкеты Заполнение в текстовом редакторе Microsoft Word следует начинать с анкеты ? ... 1 (Наукоемкий бизнес, Контрактные исследования, Консультационные услуги), заполните серые поля раздела Контактная информация и переходите к заполнению соответствующих разделов анкет ? ... АНКЕТА ? ... 3) Вы уже являетесь участником малой инновационной компании | ... профессиональной области: научные консультации, образовательные | ... Химия, химическая технология, новые материалы | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/Anketa.%20Technological%20audit.doc -- 102.0 Кб -- 14.10.2006 Похожие документы
... Physics Around the World: Physics Journals . ... Physical Review C . ... Библиотеки в Сети . ... Научная библиотека МарГУ * Библиотеки России . ... Научная электронная библиотека РФФИ (e-Library.RU) . ChemWeb Library . ... Поиск научной литературы . ChemWeb Library Search полнотекстовый поиск статей в по ключевым словам в электронной библиотеке ChemWeb. ... Scirus.com поисковая система осуществляет поиск сразу в нескольких ведущих электронных библиотеках научной литературы . ... поиск | ...
... О физическом факультете . ... Физический факультет . ... Расписание письменных вступительных испытаний на физический факультет МГУ для отдельных категорий граждан (вместо ЕГЭ). ... физического факультета МГУ в 9.15. 1. 12 июля 2010 года. ... Начало испытания в 10.00. 14 июля 2010 года в 16.00 в корпусе физического факультета (аудитория ЦФА) состоится консультация. ... Апелляции будут проводиться с 16.00 до 18.00 в помещении приемной комиссии физического факультета МГУ. 3. 19 июля 2010 года. ...
... 53, Moscow, 117924 Russia *e-mail: grishan@comsim1.phys.msu.su **e-mail: zadkov@comsim1.phys.msu.su Received August 30, 2002 Abstract-- universal theory for calculating coherent population trapping resonances in multilevel atoms is suggested. ... Numerical simulation of coherent population trapping resonances shows that the open character of the system decreases the contrast of resonance curves in absorption spectra without changing resonance widths. ...
[
Текст
]
Ссылки http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf -- 986.4 Кб -- 04.02.2008 Похожие документы
TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...
... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Опубликована Зверева И.М. «Нестандартные задания по ядерной физике для развития творческих способностей школьников» \\ Развитие творческих способностей по физике в условиях реализации образовательных стандартов: доклады научно-практической конференции - Изд-во МГОУ, Москва, 2013. - сс.25-29 Нестандартные задания по ядерной физике для развития творческих способностей школьников Зверева И.М., НИИЯФ МГУ Наши пятиклассники показали хорошие результаты в международном тестировании TIMSS в 2011 году. ...
... On Invariant Manifolds of Nonholonomic Systems Valery V. Kozlov * V.A. Steklov Mathematical Institute Russian Academy of Sciences ul. Gubkina 8, Moscow, 119991 Russia Received December 27, 2011; accepted January 23, 2012 Abstract--Invariant manifolds of equations governing the dynamics of conservative nonholonomic systems are investigated. ... 2 2012 ON INVARIANT MANIFOLDS OF NONHOLONOMIC SYSTEMS 135 We emphasize that the system of differential equations (2.3) is closed and has the form (1.6). ...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/c61/166-on-invariant-manifolds-of-nonholonomic-systems_en.pdf -- 240.1 Кб -- 28.10.2015 Похожие документы
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf -- 1055.8 Кб -- 24.05.2002 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
. Критические заметки . о буржуазной математической логике . А.Ф.Лосев . Публикация А.А.Тахо-Годи, . подготовка рукописи к публикации и примечания . В.П.Троицкого . Опубликовано: . Историко-математические исследования, вып. 8 (43), 2003, с. 3339-401. Огромное распространение идей т.н. математической логики или логистики общеизвестно. Теперь это уже перестает быть каким-то одним из методов логики и грозит оттеснить всякую иную логику 1 . В последнем американском философском словаре 2 <...> уже нет вообще
About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...
За более чем 300-летнию историю функционирования в Саду сложились традиционные научные направления ботанических исследований, во многом связанные с работами, выполнявшимися на первых этапах его существования - поиском и выращиванием лекарственных растений, а затем, после вхождения Сада в состав университета, - с флористическими исследованиями в Подмосковье и в Европейской России, а также специальным комплексным изучением отдельных групп растений, в особенности зонтичных. ...