... Res. 46 (2014) 031420 (7pp) On the dynamics of point vortices in an annular region Nadezhda N Erdakova1 and Ivan S Mamaev 1 1,2 Laboratory of Nonlinear Analysis and the Design of New Types of Vehicles, Udmurt State ... Accepted for publication 17 April 2014 Published 28 May 2014 Communicated by Y Fukumoto Abstract This paper reviews the results of stability analysis for polygonal configurations of a point vortex system in an annular ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Демографический профиль' и динамика маркеров стресса как индикаторы среды обитания древних сообществ 2.Соотношение демографических показателей и продольных размеров скелета как показателей уровня жизни ?3.Анализ продолжительности жизни в мужских и женских выборках на примере различных социо-экономических слоев древнего населения . ... Изучение связей морфологических признаков и функциональных показателей (сердечно-сосудистой, дыхательной и др. систем организма) у юношей и девушек. ...
... СУНЦ МГУ . В 1968 годуљв Москве прошла 10-я Международная математическая олимпиада, где ученики ФМШ ?18 при МГУ завоевали 2 золотые медали. В 1969 годуључащиеся и выпускники школы открыли Заочную математическую школу для восьмиклассников . В 1964 годуљпроходит первая Летняя школа. В ней участвует 46 человек, 19 из которых составили первый класс, а затем и первый выпуск школы. В 1972љгодуљвпервые проходит посвящение в ФМШата. ... Летняя школа впервые была проведена в Москве (в ФМШ). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...
... J.-B. Lully: Atys - Acte IV . Ж.-Б. Люлли: Атис - Действие четвертое . ... Sangaride, Doris, Idas. Сангарида, Дорис, Идас. ... Quoy, vous pleurez ? ... L'Amour n'est guere heureux lorsqu'il est trop timide. ... Atys combl d'honneurs n'aime plus Sangaride. ... Et l'Ingrat n'a trouv c t honneur que trop doux ; . ... Dieux ! ... N'est-ce pas vous ingrat qui voulez que je change ? ... Mais ce n'est que pour vous que j'ay crain sa vengeance, . ... Cybele m'ayme en vain, et c'est vous que j'adore. ...
Ячейка OSA в МГУ no-pyccku in English . ... Семинар . ... Следующий семинар 21.10.2008 19:11 . ... Следующий семинар состоится 16 октября в 17.00 в ауд. ... файл 22.12.2008 17:02 . Есть 3 файлов по теме поста . ... еще раз 22.12.2008 17:14 . ... Какбэ Ксылка . ... Какбэ Осылка Пакбэ кбэ Ткбэ Тсылка ...
... Fig. ... 2.2 The dispersion law of a surface plasmon polariton (solid line) and light in vacuum (dotted line) Fig. ... An important effect in nanoplasmonics is the resonant excitation of local plasmons (LPs). ... 2.4 Experimental methods for coupling light to surface plasmons. (a) Kretschmann geometry. (b) Otto geometry. (c) Coupling SPP with a scanning near-field optical microscope tip. (d) Surface nanodefect coupling b c d 2 Recent Advances in Nanoplasmonics and Magnetoplasmonics Fig. ...
[
Текст
]
Ссылки http://nanolab.phys.msu.ru/sites/default/files/2013chapter.pdf -- 1463.6 Кб -- 16.05.2013 Похожие документы
-- MySQL dump 8.23 -- -- Host: localhost Database: slides --------------------------------------------------------- -- Server version 3.23.58 -- -- Table structure for table `book` -- DROP TABLE IF EXISTS book; CREATE TABLE book ( id_content int(11) NOT NULL default '0', title varchar(255) default NULL, text1 text, text2 text, PRIMARY KEY (id_content) ) TYPE=MyISAM; -- -- Dumping data for table `book` -- INSERT INTO book VALUES (110,'Электронный учебник','',''); INSERT INTO book VALUES
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
... Курсы . ... НАПРАВЛЕНИЕ I. (д.ф.-м.н., профессор Б.П. Рыбакин): . ... Спецкурс ?Параллельное программирование Fortran 95? ... НАПРАВЛЕНИЕ II (д.ф.-м.н, профессор Н.Н. Смирнов , к.ф.-м.н., доцент В.Ф. Никитин ) . ... НАПРАВЛЕНИЕ III (доцент В.Б. Демидович, доцент А.В. Рождественский) . ... Спецкурс љ?Математические и вычислительные методы в экономике? (доцент А.В. Рождественский) . ... Спецсеминар љ?Оптимизация в актуарной и финансовой математике? (доцент В.Б. Демидович, доцент А.В. Рождественский) ....
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
... Destructive effects of many tsunamis are confined to areas within about one hour of the initial propagation time (that is, within a few hundred km of their source). ... Two international tsunami workshops have recently been held in Russia ( "Tsunami Mitigation and Risk Assessment," Petropavlovsk-Kamchatskiy,1996 , and "Tsunami Risk Assessment Beyond 2000: Theory, Practice and Plans," Moscow, 2000). ... The final product of the workshop will be recommendations on local tsunami warning and mitigation....
Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf -- 1942.1 Кб -- 18.10.2010 Похожие документы
... Кафедра международной безопасности . Кафедра международных организаций и мировых политических процессов . Кафедра региональных проблем мировой политики . ... Практика . ... К научно-исследовательской работе на постоянной основе привлекаются сотрудники Института мировой экономики и международных отношений, Института востоковедения, Института США и Канады, Института Дальнего Востока, Института Европы, Института Латинской Америки, Института Африки, Сибирского и Дальневосточного отделений РАН. ...
... Дом Отдыха МГУ им. М.В. Ломоносова . ... Прайс лист на проживание, питание и дополнительные услуги. ... Пожалуйста, уточняйте стоимость размещения при бронировании. ... Аренда зала . 8 часов . ... 500 рублей . ... Аренда сауны: до 8 человек, парная, бассейн, комната отдыха, веники, ароматы для парной, банные принадлежности, тв-аудио аппаратура. 1 час 45 минут . ... Стоимость проживания для сотрудников МГУ 1350 рублей в сутки с 3-х разовым питанием с одного человека . ... Категория номера . ...