... Difference between workstation clusters and MPPs . Up: Special features of different systems Next: Checking your machines list Previous: Special features of different systems . ... In contrast, workstation clusters require that each process in a parallel job be started individually, though programs to help start these processes exist (see Using the secure server below). ... Using heterogeneous clusters is discussed below.) ... Центры . ...

Еще в разделе: (Показать все результаты (>288) - www.parallel.ru/ )

• mpirun | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Special features of different systems | PARALLEL.RU -

Network Working Group Request for Comments: 3587 Obsoletes: 2374 Category: Informational R. Hinden Nokia S. Deering Cisco E. Nordmark Sun August 2003 IPv6 Global Unicast Address Format Status of this Memo This memo provides information for the Internet community. ... Abstract This document obsoletes RFC 2374, "An IPv6 Aggregatable Global Unicast Address Format". ... The format of unicast address in this case is: | ... Informational [Page 3] RFC 3587 IPv6 Global Unicast Address Format August 2003 7. ...

Еще в разделе: (Показать все результаты (>18768) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc3587.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc6938.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc6938.txt

... D. Thesis . ... The Alexander Moskovsky Ph.D. thesis defence has occured on March 29, below on this page, the detailed abstract and full text of thesis are available for download (in Russian only). ... С этой страницы можно загрузить автореферат и полный текст диссертации в формате Microsoft Word . ... Автореферат . Microsoft Word (1.23 Мб) . MS Word, ZIP (1.01 Мб) . Диссертация . ... Back to Alexander Moskovsky page. Back to the main page. ...

Еще в разделе: (Показать все результаты (>19) - lcc.chem.msu.ru/ )

• History
• People
• Research Interests

Abstract "Hard X-ray generation under interaction of femtosecond laser pulses with large molecular clusters" Fedorov D.O. Investigation of hard (2-5 keV) characteristic X-rays generation produced by moderate intensity (10 16 W/cm2) femtosecond laser pulses (energy 5-7mJ) under interaction with large clusters, formed by molecules CF3I, CF2Cl2 in the presence with noble gas (Ar, He), was done for the first time . ... This may be the evidence of the argon concentration increasing in mixed clusters. ...

Еще в разделе: (Показать все результаты (>326) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Arslanov_Gordienko_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2008/Golubev_Gordienko_Djidjoev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2013/Anashkina_Chichigina_en.pdf

Beck R., Frick P., Stepanov R., Sokoloff D. Recognizing magnetic structures by present and future radiotelescopes with RM Synthesis, eprint arXiv:1204.5694, 2012. We investigate whether the method of wavelet-based Faraday rotation measure (RM) Synthesis can help us to identify structures of regular and turbulent magnetic fields in extended magnetized objects, such as galaxies and galaxy clusters. ... We present observational tests to recognize magnetic field structures. ...

Еще в разделе: (Показать все результаты (>190) - srcc.msu.ru/ )

• Beck R., Frick P., Stepanov, R., Sokoloff D. Recognizing magnetic structures by

ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...

Еще в разделе: (Показать все результаты (>45) - www.sai.msu.ru/ )

... Библиотека электронных публикаций . ... Title: Memory effects in the relaxation of Ising models . Authors: J. Javier Brey, A. Prados . Comments: 7 pages, 2 figures . ... Comments: 10 pages, 2 figures, To be published in Physica A . ... Comments: Accepted for publication in ApJ. (17 pages, 18 figures) . ... Comments: 15 pages including two postscript figures . ... astro-ph/0105073 Title: Time Dilation and Quasar Variability Authors: M.R.S. Hawkins Comments: 6 pages including 3 figures. ...

Еще в разделе: (Показать все результаты (>505) - chronos.msu.ru/ )

• Russian Interdisciplinary Temporology Seminar

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>24) - uranus.sai.msu.ru/ )

Evaluation of clusters with AMD Barcelona and Shanghai CPUs and Infiniband DDR and QDR interconnects" . Kudryavtsev M.V., Moshkin D.V., Polunin M.A., Aisymont L.K. A methodology for the performance evaluation of clusters with quadsocket and dualsocket Supermicro boards with AMD Barcelona (clock rate 2,0 GHz, peak performance 32 Gflops) and AMD Shanghai (clock rate 2,6 GHz, peak performance 41,6 Gflops) CPUs, Infiniband 4X DDR and 4X QDR interconnects is proposed. ...

Еще в разделе: (Показать все результаты (>289) - num-meth.srcc.msu.ru/ )

• "Optimization algorithms for DSMC computations on parallel clusters"
• "Implementation of the lattice Boltzmann method on GPU clusters"
• "An expandable monitoring system for computing clusters"

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Moscow State Uiversity . ... STRATEGY: numerical methods for hydrodynamics in porous media . ... AREA: Geophysics, Mechanics . ... AREA: Geophysics, Geology . ... STRATEGY: Numerical simulation of seismic wave propagation in models with complex fluid-filled structures using grid-based multi-scale methods (finite difference, finite elements). ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>68) - hpc.msu.ru/ )

• CLEO: USER & ADMIN-FRIENDLY CLUSTER BATCH SYSTEM | Moscow University
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center
• APPLICATIONS: Inorganic Chemistry | Moscow University Supercomputing Center

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>233) - www.genebee.msu.ru/ )

• OUTPUT
• GEA :: Gene Expression Analysis
• Databases

... Physics Department . ... Home :: Directions of Research :: Polymers with Associating Groups (experiment + theory + computer experiment) Structure and properties of aggregates, multiplets and clusters. ... Polymers with Strongly Interacting Groups: Theory for Non-Spherical Multiplets. ... Computer Simulation of Solutions of Telechelic Polymers with Associating End-Groups. ... Home :: Directions of Research :: Polymers with Associating Groups (experiment + theory + computer experiment) . ...

Еще в разделе: (Показать все результаты (>360) - polly.phys.msu.ru/ )

• Seminar in Polymer Physics
• Научный семинар
• PSMTLab - Сотрудничество и Совместные проекты

... Larin A.V, Rybakov A.A., Zhidomirov G.M. Journal of Physical Chemistry C, 116, 2399-2410 (2012). ... Larin A.V, Rybakov A.A., Zhidomirov G.M., Mace A., Laaksonen A., Vercauteren D.P. Journal of Catalysis, 281, 212-221 (2011). ... A.A. Rybakov, A.V. Larin, G.M. Zhidomirov, D.N. Trubnikov, D.P. Vercauteren . ... A. A. Rybakov, E. D. Belega, and D. N. Trubnikov . Journal of Chemical Physics, 133, 144101 (2010) . ... The following article may be found on the site of Journal of Chemical Physics.) ...

Еще в разделе: (Показать все результаты (>25) - beams.chem.msu.ru/ )

Current Issue About us Editors Board of Editors Guidelines Contacts . ... 2015 . ... The author proposes a new direction of food market development, emphasing the formation of food clusters as an instrument of unlocking the potential of Ukrainian manufacturers. ... Cluster, block, sector, food market, business. ... No material published in this journal may be reproduced in print or in electronic form without a link to "E-journal. Public Administrarion". ... Copyright ї 2015 SPA MSU . ...

Еще в разделе: (Показать все результаты (>529) - ee-journal.spa.msu.ru/ )

... Faculty of Physics . ... 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Research Centers . ... Education . ... Research . ... Education research . ... Research Highlights of the Year . Research Highlights Archive . ... 05.09.2003 XIV Symposium on Atomic, cluster, and Surface Physics (SASP 2004) . ... 7 495 939-16-82, . Fax: +7 495 932-88-20, . ... Faculty of Physics, 2016 . ... the Ministry of Education and Science . ...

Еще в разделе: (Показать все результаты (>434) - phys.msu.ru/ )

• Title

. [ Go back to RadioAstronomy Dept ] . Andrew A. Martis . martis @ sai.msu.ru .

Еще в разделе: (Показать все результаты (>82) - comet.sai.msu.ru/ )

• Dm. Bizyaev Home Page

... December 13, 1997 . The Coma Cluster of Galaxies . ... The Coma Cluster of Galaxies pictured is one of the densest clusters known - it contains thousands of galaxies . Each of these galaxies house billions of stars - just as our own Milky Way Galaxy does. ... In fact, the Coma Cluster is so big it takes light millions of years just to go from one side to the other! Most galaxies in Coma and other clusters are ellipticals , while most galaxies outside of clusters are spirals . ...

Еще в разделе: (Показать все результаты (>67) - www.arcetri.astro.it/ )

• APOD: 2000 January 12 - NGC 6791: An Old, Large Open Cluster
• APOD: January 6, 1999 - M6: The Butterfly Cluster
• APOD: 2000 August 4 - M15: Dense Globular Star Cluster

39. http://acat02.sinp.msu.ru/presentations/konash/Slides_ACAT2002.doc

40. Index of /Structure/Linguistics/yakubovich/download