. Professor Igor Ya. ERUKHIMOVICH . Head Researcher (INEOS) . Adjunct Head Researcher (MSU) . CV . Scientific Results . Teaching and Students . Publications . Collaborators . Talks and Visits . Changed: September 10, 2013 .

Еще в разделе: (Показать все результаты (>215) - polly.phys.msu.ru/ )

Laboratory of Informatics . Head of Laboratory E.S.Polischuk, senior researcher, DSc . ... research guidance of a four year student's project in the Faculty of Geography (N.M. Chernavskaya, DSc) . ... Grant of RFBF (Russian Foundation for Basic Research) 01-03-00332, the head of the project prof. R.B.Rybakov, Institute of Orientalistic (Russian Academy of Science), N. M. Chernavskaya - performer . ... N.M.Chernavskaya, DSc, senior researcher, T.B.Pleskacheva., DSc, senior researcher. ...

Еще в разделе: (Показать все результаты (>186) - srcc.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form
• Best search engines for finding scientific information in the Internet:

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>48) - cryst.geol.msu.ru/ )

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>66) - geophys.geol.msu.ru/ )

... Faces of Russian Servers . ... List of the Russian Web Servers . ... Search Collection . Geographical Index of Russian WWW Servers . about laboratory | ... administration | ... search | ... Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. If you have any questions or cannot find the information you need, mail to webmaster . Last updated 20 April 2001 . ...

Еще в разделе: (Показать все результаты (>41) - www.kge.msu.ru/ )

• Scientific journals

. [ A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z ] . UNIX commands . online manual . organisation of . printing pages from . searching . viewing contents of . options . for commands . output, standard . redirecting .

Еще в разделе: (Показать все результаты (>286) - comet.sai.msu.ru/ )

• Index: V
• Index: S
• Index: E

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . О библиотеке . Новости библиотеки . ... История библиотеки . ... Основная литература . ... Дополнительная литература . ... Официальный сайт МГУ . Сайт физфака МГУ . Сайт Библиотеки МГУ . ... Кистович А.В. Показеев К.В. "Физика моря". Кистович А.В. Показеев К.В. Степанова Е.В. Пособие по дисциплине "Основы акустики океана". ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>10) - wwwlib.phys.msu.ru/ )

• Библиотека физичеcкого факультета МГУ - Электронные ресурсы
• Библиотека физичеcкого факультета МГУ - Общая информация для студентов

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

... Кустов М.Л., проф., д.х.н. This original course of lectures in English represents a survey of modern trends in chemistry, including: . Application of principles of 'green' chemistry in the synthesis of organic and iorganic products, including nanomaterials, for instance the synthesis of less toxic nanomaterials, . ... Non-traditional methods of performing the chemical processes of synthesis of organic and inorganic products (microwave activation, low-temperature plasma), . ...

Еще в разделе: (Показать все результаты (>680) - chem.msu.ru/ )

• Systematical Search for New Types of Chemical Interconversions: Mathematical

... I determine th as a time period (from some moment in the past till the present moment) during which papers responsible for 1/2 of the total citation index were published. Parameter Nt represents averaging of the citation index over this period: Nt = C.I./2th 1 Intro duction The problem of estimation of an impact of a scientist (or a group of them) is an actual one (see, for example, [1] and references therein). ... One published in 1965 a paper with C.I.=5000, and nothing after that. ...

Еще в разделе: (Показать все результаты (>752) - xray.sai.msu.ru/ )

• http://xray.sai.msu.ru/~polar/html/publications/citation/citation2.ps
• http://xray.sai.msu.ru/~polar/html/book/others.html
• Bookmarks for Mikhail E. Prokhorov

Backlinks to VarSEARCH in System Web ( Search all webs ) . ... Overview Next to freeform topic contents, each topic can store .. NEW - 14 Mar 2011 - 23:35 by ProjectContributor . ... NEW - 23 Aug 2010 - 13:36 by ProjectContributor . ... NEW - 27 Feb 2011 - 20:56 by ProjectContributor . ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... Search Help Search basics By default a search looks into topic titles, topic texts and form fields in the current web. ... See SEARCH and QuerySearch .. ...

Еще в разделе: (Показать все результаты (>23262) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) VarSEARCH < System < Foswiki
• WebLeftBar < PracticumV < Foswiki
• PerlDoc < System < Foswiki

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Chemists, Attention! Search on databases! ... Search on databases! [ re: olenka_chem ] . ... Search on databases! [ re: egoist ] . ... Из: IT UK CH . ...

Еще в разделе: (Показать все результаты (>7622) - www.fds-net.ru/ )

• searching: a bit of Fry and Laurie (3-4) - Public forum of MSU united student
• Searching for Андрей Халявин - Public forum of MSU united student networks
• Аналитик Executive Search - Public forum of MSU united student networks

... 22/042008 15:16 edneral 22/042008 15:15 edneral 05/032008 10:33 edneral 31/012008 17:54 edneral 14/012008 15:14 admin 14/012008 15:11 admin Links to calg:calg changed to calg:main 14/012008 15:08 kryukov 14/012008 15:08 kryukov 16/112007 12:49 kryukov 16/112007 12:47 kryukov 16/112007 12:45 kryukov 16/112007 12:43 kryukov 19/042007 10:49 kryukov 14/032007 13:15 kryukov 11/012007 09:04 kryukov 13/122006 12:34 kryukov 13/122006 12:34 kryukov 13/122006 12:33 kryukov 10/102006 18:26 kryukov Go . ...

Еще в разделе: (Показать все результаты (>32327) - theory.sinp.msu.ru/ )

• calg:archive07 [THEP]
• calg:sidebar [THEP]

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>16673) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/hg/allpy/raw-rev/027f0f2f5417
• http://kodomo.fbb.msu.ru/hg/allpy/raw-rev/00d6145cba0f
• allpy: ddf85d0a8924 allpy/markups.py

... Fursikov Andrei Vladimirovich . Head of the Department . ... Navier-Stockes equations, statistical hydrodynamics, theory of control for systems with distributed parameters. student of Mark Iosifovich Vishik . ... He is a member of the editorial board of "Journal of Dynamical and Control Systems", "Journal of Mathematical Fluid Mechanics", "Interdisciplinary Math. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>216) - new.math.msu.su/ )

• Who worked here | Department: General Problems of Control. Faculty of Mechanics
• Classes | Department: General Problems of Control. Faculty of Mechanics and
• History | Department: General Problems of Control. Faculty of Mechanics and

Web of Science http://isiknowledge.com Web of Science , ( ) , . Web of Science. Search, Cited Reference Search Advanced Search, (Search History) (Marked List) 1. ... Science Citation Index Expanded (SCI-EXPANDED) ­ Social Sciences Citation Index (SSCI) ­ Arts & Humanities Citation Index (A&HCI) ­ . ... Marked List), . ... Analyse Results Create Citation Report. ... Cited Reference Search Web of Science , , / . Search (). ... Add to Marked List. Add to Marked List, , Marked List , . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2362) - swx.sinp.msu.ru/ )

• Index of /models/database/db/001124
• Index of /models/database/db/010402
• Index of /models/database/db/000912

. Name . Last modified . Size . Description . Parent Directory . - . base-menu.html . 2010-04-01 21:22 . 162 . base.html . 2010-04-01 20:07 . 278 . hello.html . 2010-04-01 18:32 . 166 . search.html . 2010-04-01 21:28 . 375 . Apache/2.4.12 (Debian) Server at kodomo.cmm.msu.su Port 80

Еще в разделе: (Показать все результаты (>83) - kodomo.cmm.msu.su/ )

• Index of /~dendik/data/python
• Index of /~dendik/data/python/2010-03-17
• Index of /~dendik/data/python/2010-03-31