... This book contains scientific papers prepared by researchers of Moscow State University and Autonomous University of Puebla in accordance with a special Russian--Mexican scientific program. ... Institute of Mathematical Studies of Complex Systems, Moscow State University . ... Institute of Nuclear Physics, Moscow State University . ... The book is edited by Rector of Moscow State University Dr. V.A. Sadovnichii and Rector of Autonomous University of Puebla Dr. E. Doger Guerero. ...

Еще в разделе: (Показать все результаты (>175) - num-anal.srcc.msu.ru/ )

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>4) - www.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Fast Facts about the Faculty of Journalism . ... Partners . ... All partners . ... 14.11.2012 Researchers from the Faculty of Journalism, Lomonosov Moscow State University took part in the 4th ECREA (European Communication Research and Education Association) conference. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>169) - www.journ.msu.ru/ )

• National association of mass media researchers (NAMMI) (president - Prof. Elena
• The Researchers and Journalists discussed the Pseudo-science at the Faculty of
• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span

... Research . ... Staff . ... PhD . ... Head of Laboratory, . Professor, Doctor (chem. sci.) ... PhD, senior researcher . ... Dr. (tech. sci.), prinsipalљresearcher . ... PhD, juniorљresearcher . ... Dr. (tech. sci.), principalљresearcher . ... PhD, principalљresearcher . ... Dr. (chem. sci.), principalљresearcher . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• TernAPI program Laboratory of Chemical Thermodynamics
• Colloquium on 09.11.12 Laboratory of Chemical Thermodynamics
• Colloquium on 28.04.11 Laboratory of Chemical Thermodynamics

... The approach for estimation of the homology search program sensitivity in nucleotide case was proposed in paper I.Anderson, A.Brass , "Searching DNA databases for similarities to DNA sequences: when is a match significant?" ... Seven sequences were chosen to have length varying from 100 to 1000 bp. ... Each of the 1000 artificially evolved sequences was used as a query for database search with Genebee search, blast-2.0.8 and fasta-3.3 as search engine. ... Sequence length . ... 100 . ... Blast 2.0 ....

Еще в разделе: (Показать все результаты (>290) - www.genebee.msu.ru/ )

• GeneBee
• Selected Scientific Journals - Search Engines
• The GeneBee Group

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• Поиск новых кристаллических материалов, исследование их свойств и процессов

... FAQ: I've problems with the nop WebSearch. ... Answer: That is an indication ... changed on 2005-03-27 - 13:14 by TWikiContributor . ... Answer: TWiki allows multiple simultaneous edits of the same topic, and then merges the ... changed on 2005-03-27 - 13:14 by TWikiContributor . ... most recent topic changes in webs Last Modified Web.Topic Last Editor %SEARCH{ "." type "regex" nosearch "on" nototal "on" limit "" web "" excludetopic ... changed on 2006-11-15 - 19:43 by TWikiContributor . ...

Еще в разделе: (Показать все результаты (>50093) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (2 vs. 3) - TWiki
• %TOPICTITLE% (17 vs. 18) - TWiki

THE REETHERM DATA BANK FOR MODELING OF GEOCHEMICAL PROCESSES WITH PARTICIPATION OF RARE-EARTH ELEMENTS K.G.Morgunov, G.R.Kolonin, G.P.Shironosova Institute of Mineralogy and Petrography SB, RAS, Novosibirsk This study was supported by the Russian Fundamental Research Foundation (Project No. 98-05-65299) and by the program Universities of Russia - fundamental researches (grant 2787) Herald DGGGMS RAS 5 (15)'2000 v.2 URL: http://www.scgis ...

Еще в разделе: (Показать все результаты (>954) - geo.web.ru/ )

• http://geo.web.ru/COMPASS/iitp.html
• Trusov Sergey's homepage Curriculum Vitae of Trusov Sergey Viktorovich
• Представление специалиста

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>40) - hit-conf.imec.msu.ru/ )

• Moscow 2006
• Untitled

Online Services | ... Research) IPN(Institute Physics Nuclear, Paris) ISN(Institute Science Nuclear, Grenoble) JINR(Joint Institute Nuclear Research) JUL-Spez(Institute fur Kernphysik) JYFL(University Jyvaskyla, Finland) LA(Los Alamos Science Laboratory) LBL(Lawrence Berkeley Laboratory) NEANDC(Nuclear Data Committee) ORNL(Oak Ridge National Laboratory) UTTAC(University Tsukuba Center) ZFK(Zentralinstitut fur Kernforschung) **************************************************** Other Code . ... Code: . ...

Еще в разделе: (Показать все результаты (>50) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• EXFOR Search Engine
• CDFE => Online Services

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Next-Generation Electronic Materials Lab . ... Optoelectronic materials, optoelectronic devices, functional organic polymers, and electronic materials . ... Research and development (RnD) in the field of optoelectronic materials, optoelectronic devices, functional organic polymers, and other electronic materials for next-generation electronic, photonic, and IT devices . ... Research and development of optoelectronic materials . ...

Еще в разделе: (Показать все результаты (>169) - www.physcareer.ru/ )

• SENIOR RESEARCHER/ ENGINEER / Вакансии / Physcareer.ru
• RESEARCHER / Вакансии / Physcareer.ru
• Senior Director Engineer / Scientist / Researcher (Next Generation Electronic

Press release 20 July 2011 New funding for early-career top researchers from anywhere in the world: 730 million for new "ERC Starting Grant" call The European Research Council (ERC) today opens its fifth call for proposals for the "ERC Starting Grants", targeted at early-career top researchers of any nationality, working - or moving to work - in host institutions in Europe. ... Last year, the success rate of Starting Grants proposals was around 15%. ...

Еще в разделе: (Показать все результаты (>45) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf
• http://ideas.msu.ru/docs/press_release_2011.pdf
• Конкурсы

... It was the natural continuer of scientific researches of the Central Asia which were carried out by the Russian Geographical society, expeditions of the Academy of Sciences of USSR and the Mongolian Science Committee. ... Researches of the nature of Mongolia carried out by JRMCBE, include seven basic directions: . studying flora and fauna; . ... In the first period, the basic direction of researches of the Expedition included studying floristic riches of the country, its basic types of vegetation. ...

Еще в разделе: (Показать все результаты (>5861) - www.sevin.ru/ )

• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: II
• Laboratories: Laboratory for ecology of aquatic communities and invasions:
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: III

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>25) - uranus.sai.msu.ru/ )

• Igor Antokhin
• Nikolay Bochkarev
• Eugene Trunkovsky

... chief researcher G.N.Simkin , prof. I.R.Beme , researcher S.M.Smirenskiy , senior researcher N.D.Poyarkov , researcher V.B.Masterov , senior researcher M.Yu.Soloviev , researcher V.D.Anisimov , leading engineer M.N.Dementiev . ... chief researcher G.N.Simkin , prof. I.R.Beme , leading researcher V.M.Gavrilov , researcher A.B.Popovkina , senior researcher N.D.Poyarkov , researcher V.B.Masterov , senior researcher M.Yu.Soloviev , junior researcher E.N.Rahimberdiev , leading engineer M.N.Dementiev . ...

Еще в разделе: (Показать все результаты (>91) - vertebrata.bio.msu.ru/ )

• Laboratory of Ecology of Terrestrial Vertebrates
• Courses
• Laboratory of Vertebrate Behaviour

... Senior Lecturer, Chair of General Physics, Physical Department, Moscow State University; Ph.D. Igor I. Vlasov . Senior Researcher, Center of Research in Natural Sciences, Institute of General Physics of RAS; Ph.D. Igor G. Persiantsev . ... The Nesmeyanov Institute of Organoelement Compounds of Russian Academy of Sciences. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>47) - rswater.phys.msu.ru/ )

• Sergey Burikov
• Tatiana Dolenko

... This course focuses on main characteristics of the ?life? of academic information (its development and diffusion), and on basic algorithms of data retrieval. ... This course consists of four interrelated areas: theoretical introduction (Internetics and information theory), and practical units including the three pillars of information retrieval services: factual, bibliographic and documentary search. ... Factual search. ... Internet-heuristics strategies: summarizing information retrieval skills . ...

Еще в разделе: (Показать все результаты (>405) - hist.msu.ru/ )

• The Food Supply Problem and the Ways Overcoming it in Eastern Siberia in the
• "Novaya i noveishaia istoria" Journal
• О Центре экономической истории

07.02.1953; Penza, Russia Senior Researcher, Laboratory of Physical Chemistry of Polymers, A.N. Nesmeyanov Institute of Organoelement Compounds of the Russian Academy of Sciences, Vavilov St. 28, 119991, Moscow, Russia. Tel: 7(499)135-6457; Fax: 7(499)135-5085; e-mail: burova@ineos.ac.ru . ... 1987 : Visiting scientist at the Central Institute of Genetics of the Academy of Sciences of GDR (Gatersleben, GDR) and at the Central Institute of Nutrition of the Academy of Sciences of GDR (Potsdam, GDR). ...

Еще в разделе: (Показать все результаты (>563) - polly.phys.msu.ru/ )

• History of Research - Chair of Polymer and Crystal Physics
• Main - Chair of Polymer and Crystal Physics
• Personnel - Chair of Polymer and Crystal Physics

... Полная версия этой страницы: Openings for post-doctoral audio researchers at Microsoft Research . Студенческий форум Физфака МГУ > Общий > Работа . ... researchers in the area of audio research. ... Microsoft Research . One Microsoft Way . ... Web: http://research.microsoft.com/en-us/people/ivantash/ . Post-doctoral researcher openings . Post-doc openings for audio processing research Microsoft Research . ... post-doctoral researchers in the general area of audio signal processing. ...

Еще в разделе: (Показать все результаты (>5460) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Free Researcher родился
• Openings for post-doctoral audio researchers at Microsoft Research -
• Студенческий форум Физфака МГУ > Скандал с продолжением?