Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

ABOUT ONE METHOD OF CALCULATION AVERAGE VALUE OF THE PARAMETER USING MEASUREMENTS' WEIGHTS Mitina O.V., Mitin V.I. 1 MSU, dept. of psychology, 125009, Moscow, Mokhovaya.11, b. 5, omitina@yahoo.com Russian Research Center "Kurchatov Institute", valentinmitin@yahoo.com. ... Here we suggest the following method iterative algorithm calculating. ... Weight functions on an iterative step j are calculated using the formula wij = 1 j 2 exp[( N i - N N i wij wij j- 1 ) 2 / 2 2j ] . ...

Еще в разделе: (Показать все результаты (>258) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc174331/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc184890/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc151854/eng.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/nikitin/posterACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/tobimatsu/tobimatsuk.pdf
• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf

... 3D magnetosphere . ... Data . ... Magnetosphere . ... Magnetic field at the selected point Module of the Magnetic field distribution along Sun-Earth line Noon-Midnight magnetosphere structure . ... Point coordinates, where magnetic field will be calculated: . ... Magnetic field at MD outer edge . ... Magnetic field at TC inner edge . ... Distance to external edge of MD . ... Distance to inner edge of MD . ... Magnetopause stand-off distance . ... Distance to inner edge of geotail current sheet . ...

Еще в разделе: (Показать все результаты (>97) - swx.sinp.msu.ru/ )

System parameters on Digital UNIX . ... Digital and Cray use the number of bytes as the KIND -parameter. ... LOGICAL Default byte word KIND number = 4 1 4 LOGICAL Default double quad KIND number = 4 8 16 INTEGER int15 int31 int63 KIND number = 2 4 8 digits = 15 31 63 radix = 2 2 2 range = 4 9 18 huge = 32767 2147483647 9223372036854775807 bit_size = 16 32 64 REAL single double quad KIND number = 4 8 16 digits = 24 53 113 maxexponent = 128 1024 16384 minexponent = -125 -1021 -16381 ...

Еще в разделе: (Показать все результаты (>2879) - crydee.sai.msu.ru/ )

• Relationship Between Auto Chirplet FF Plane and Radon Transform
• Gaussian Chirplet Transform (GCT)
• Energy distribution

... In studies such as those of Dziewonski [1984 ], Woodhouse and Dziewonski [1984 ] or Tanimoto [1990 ] it was assumed a priori that the lateral variations in the structure could be represented by a spherical harmonic expansion truncated at some low degree such as 6 or 8. ... A very similar spectrum (up do degree 8) is obtained by predicting the SS data from 3-D models such as an upper mantle model M84C [ Woodhouse and Dziewonski, 1984 ]. ... U.S. National Report to IUGG, 1991-1994 . ...

Еще в разделе: (Показать все результаты (>403) - geo.web.ru/ )

• Trusov Sergey's homepage The influence of boundary layer effects on the melt
• The influence of boundary layer effects on the melt inclusions compositions.

... Accepting Arguments . ... PHP's implementation of variable arguments in fsockopen(). pval ** args [5]; int *sock=emalloc(sizeof(int)); int *sockp; int arg_count = ARG_COUNT (ht); int socketd = -1; unsigned char udp = 0; struct timeval timeout = { 60, 0 }; unsigned short portno; unsigned long conv; char *key = NULL; FLS_FETCH(); if ( arg_count 5 || arg_count 2 || zend_get_ parameters _array_ex( arg_count , ... Old way of retrieving arguments (deprecated) . ... Accessing Arguments ...

Еще в разделе: (Показать все результаты (>642) - oit.cmc.msu.ru/ )

• Assuring Write Safety for Other Parameters
• pdf_get_pdi_parameter
• pdf_get_parameter

... Fursikov Andrei Vladimirovich . Head of the Department . ... Navier-Stockes equations, statistical hydrodynamics, theory of control for systems with distributed parameters. student of Mark Iosifovich Vishik . ... He is a member of the editorial board of "Journal of Dynamical and Control Systems", "Journal of Mathematical Fluid Mechanics", "Interdisciplinary Math. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>59) - new.math.msu.su/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>67) - electr003.chem.msu.ru/ )

... This gropup of options allows You to change the following speech recording parameters: . ... This gropup of options allows You to change the following parameters of linear prediction: coefficients calculation: . ... This gropup of options allows You to change the following speech processing parameters: . ... This gropup of options allows You to change the following speech recognition parameters: . ... This gropup of options allows You to change the following speech detection parameters: . ...

Еще в разделе: (Показать все результаты (>91) - www.intsys.msu.ru/ )

• Options
• Intelligent Systems :: Research :: :: Articles
• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly

Next: Defining the Local Mailer Up: Typically Used sendmail.m4 Parameters Previous: Typically Used sendmail.m4 Parameters . LIBDIR defines the directory where sendmail+IDA expects to find configuration files, the various dbm tables, and special local definitions. ... To change the location of the support files to a different location, remove the leading dnl from the above line, set the path to the desired location, and rebuild and reinstall the sendmail.cf file. ...

Еще в разделе: (Показать все результаты (>338) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• All About ifconfig
• Defining the Local Mailer

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>22) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gamkrelidze.pdf

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>37490) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

... Data . ... Models . Solar energetic particles . Paraboloid model . ... Neutron flux variations (RU) . ... This program package is intended to prognose the environment on the board of near-earth elliptic orbiting satellites in the open space as well as behind the Al shielding. ... Next is the required spectrum type (integral or differential). ... sp_x.txt - solar proton spectrum behind shielding, fluence . sn_x.txt - solar neutron spectrum behind shielding, fluence . ... Solar . ...

Еще в разделе: (Показать все результаты (>36) - smdc.sinp.msu.ru/ )

• APEV service - Space monitoring data center
• Paraboloid model of the Earth's magnetosphere - Space monitoring data center
• Space monitoring data center

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Vishnevskiy Yury V. , Tikhonov Denis . ... Vogt N. , Vishnevskiy Y.V. , Ivanov A.A. , Vogt J., Vilkov L.V. в журнале Russ. ... Dorofeeva O.V. , Vishnevskiy Y.V. , Moiseeva N.F. в журнале Structural Chemistry , издательство Springer-Verlag (Heidelberg, Germany) , том 17, ? ...

Еще в разделе: (Показать все результаты (>1888) - istina.msu.ru/ )

• Montuoro R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Journal of Parallel and Distributed Computing - журнал | ИСТИНА -
• IEEE Distributed Systems Online - журнал | ИСТИНА - Интеллектуальная Система

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>6) - angel.cmc.msu.ru/ )

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . Publication type . Conference paper . ... 21-th International Conference on Computer Graphics GraphiCon'2011 . ... Title = {Algorithms for calculating parameters of virtual scenes in computer vision tasks}, . ... BookTitle = {21-th International Conference on Computer Graphics GraphiCon'2011}, . ...

Еще в разделе: (Показать все результаты (>288) - imaging.cmc.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>26) - curl.sai.msu.ru/ )

bJ/J/ decay within light cone formalism V.V. Braguta Institute for High Energy Physics Protvino, Russia Hard exclusive processes Exclusive processes : 1. Decays : b J / J / ,.. ... 0 > (nonperturbative effects) The leading twist distribution amplitude Operators that contribute at the leading order approximation: < M(p)|q 5 D 1 .. D n q|0 > z z ...z 1 n ~ (pz) n +1 -1 1 d n ( ), z 2 = 0, = x1 - x2 Distribution amplitude ( ) can be considered as a meson wave function. ...

Еще в разделе: (Показать все результаты (>185) - nuclphys.sinp.msu.ru/ )

• The European X- Ray Free-Electron Laser