... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>182) - graphics.cs.msu.ru/ )

• Smart brightness and contrast correction | Лаборатория компьютерной графики и
• Smart brightness and contrast correction | Graphics and Media Lab
• Videocodecs tuning | Graphics and Media Lab

Modules | ... Apache HTTP Server Version 2.0 . ... ISAPI Extensions within Apache for Windows . ... isapi_module . ... It allows Internet Server extensions ( e.g. ISAPI .dll modules) to be served by Apache for Windows, subject to the noted restrictions. ISAPI extension modules (.dll files) are written by third parties. ... In the server configuration file, use the AddHandler directive to associate ISAPI files with the isapi-handler handler, and map it to them with their file extensions. ...

Еще в разделе: (Показать все результаты (>364) - uneex.lorien.cs.msu.su/ )

• mod_ext_filter - Apache HTTP Server
• HelpOnMoinCommand/ExportDump - UNИX
• Глава 8. Другие возможности

Documentation on Firefly v. 8.0.0 numerical gradient features . The numerical gradient code is activated as follows: . ... The primary purpose of this code is to allow computations normally requiring analytic energy gradients, to be performed using those QC methods for which analytic gradients are not yet programmed. ... The numerical gradients code is tightly integrated into Firefly and can be used anywhere where the analytical energy gradients are required by default. ... The default is 2. ...

Еще в разделе: (Показать все результаты (>68) - classic.chem.msu.su/ )

• Notes on some of Firefly's specific features
• PC GAMESS/Firefly DOCUMENTATION - SMP, multicore and HTT features
• PC GAMESS/Firefly DOCUMENTATION - Potential Energy Surface (PES) scan features

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements of  the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"

... О UNИX . ... ExportDump . ... Example with --page parameter using regular expression . Output . ... Known limitations "moin export dump" is an HTML export utility to create static HTML dumps of wiki content. ... The --page parameter is optional and will dump pages matching the pagename. ... With the parameter, the output is limited by ACL rules to pages that can be read by the username. ... Note the --page , --target-dir , and --username parameters must follow the export dump parameters. ...

Еще в разделе: (Показать все результаты (>148) - uneex.mithril.cs.msu.su/ )

• HelpOnInstalling/Win32MoinEasyBackup - UNИX
• SyncJobTemplate - UNИX

... 2.5 ISR 63 GeV |y| 2 NA5 19 GeV |y| 1.5 ISR 31 GeV |y| 2 N_ch 2 Regge-Gribov multipomeron approach Probability of production of n pomerons ' ' where n ґ cross section of n cut ... parameters used [1]: [1] Lakomov I. A., Vechernin V. V. , PoS (Baldin ISHEPP XXI) 072 (2012) 4 Regge-Gribov multipomeron approach Mean and variance of the number of pomerons: Variance Mean 5 Description of multiplicity Probability for n strings to give N ch ... Possible solution ґ string interactions. ...

Еще в разделе: (Показать все результаты (>175) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010_-_Sukachev.pdf
• http://qfthep.sinp.msu.ru/talks/RussoQFTHEP2010.pdf
• http://qfthep.sinp.msu.ru/talks2011/Kanshin_qfthep.pdf

... The determination of parameters of . the gravity anomalies sources . ... The interpretation of sources of the anomalies of the Earth's gravity field is carried out. ... 2) в общем неравновесном поле Земли учтено влияние масс рельефа планеты, компенсированного на некоторой глубине : . ... средний радиус поверхности рельефа, - средний радиус поверхности относительности, где - средняя глубина компенсации, - средняя плотность масс рельефа, - средняя плотность Земли. ... Параметры источников . ...

Еще в разделе: (Показать все результаты (>168) - lnfm1.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Data Center (NSDC). Parameters
• IMCCE-SAI: Natural Satellites Service. Parameters and constants

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>37) - biochem.bio.msu.ru/ )

... My research topic is application of the theory of dynamical systems to models of excitable media. ... One of the remarkable examples of an excitable medium is heart tissue. ... We have observed dynamics of phase singularities using some of the techniques for PS detection on the base of just one framework three-variable Fenton-Karma model with different parameters sets to reproduce various mechanisms of spiral wave breakup which in principle can occur in cardiac tissue. ...

Еще в разделе: (Показать все результаты (>228) - polly.phys.msu.ru/ )

• PROJECT 01-0172
• Mike Thamm - feature not released

... Use Insert and Delete buttons to edit the dictionary. ... Use Clear training button to clear the previos training. ... Use the Enroll button to train the selected command. ... Don't forget to train spectral channels after changing the Engine options. ... To start training, press button and say a speech command to microphone. ... Training spectral channels . To train channels, just press the "Channels setup..." button, press "Reset all channels", then "Train all channels". ...

Еще в разделе: (Показать все результаты (>47) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Research
• Options
• Options dialog

vkgris@mail.ru The opportunity of detection and diagnostics of nano-object parameters in matter by relativistic electrons x-ray radiation generated in an investigated object is discussed. Polarization bremsstrahlung radiation (PB) of relativistic electrons on matter electrons is considered. ... C60 (60)2 (!) ... Grishin V.K. Polarization radiation from relativistic electrons in matter containing fullerenes// Nuclear instruments and Methods in Physics Research B, 2005, v.227, N 1-2, 82-86. ...

Еще в разделе: (Показать все результаты (>208) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/epp10/XING.pdf
• The European X- Ray Free-Electron Laser

M.H. Shulman, 2006 Michael H. Shulman TIME AND QUANTUM BEHAVIOR The paper presents an abstract of my talk at the Russian Interdisciplinary Temporology Seminar (23 of May, 2006th ). ... The following statements are argued: Ї The World time-space structure including its relativistic features are due to the quantum object features. Thanks to de Broglie we understood that each quantum object corresponds with some wave. ... A mathematic "exotics" of the quantum physics consists in two components. ...

Еще в разделе: (Показать все результаты (>383) - chronos.msu.ru/ )

• The biotic conception of aquatic ecosystem control

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>38) - smdc.sinp.msu.ru/ )

• Paraboloid model of the Earth's magnetosphere - Space monitoring data center

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>56) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

... Recommended values . Start word length . Start length of motiff for Multiple sequence alignment. ... Max N Mismatches . ... Min score . ... Gap parameter . This parameter defines gap scoring. the grater this value is the stronger gap will be panalysed . ... If inforation content of a column is less than given value the column should be not included into alignment. the grater this value is the stronger gap will be panalysed . ... Max loop . Max energy of a helix . ... cgcatagctc cacca . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

• input

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

39. http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc

40. University Satellites and Space Science Education '2006