SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>2648) - monkey.belozersky.msu.ru/ )

G Karshenboim Pulkovo observatory () (St. Petersburg) and Max-Planck-Institut fЭr Quantenoptik (Garching) Outline structure of input and output auxiliary data Rydberg and Rp me/mp independent constants G k h mass of a particle progress: 2006 vs. 2010 problems Structure of the input data and output values Auxiliary input data Auxiliary data = exact + the most accurate ... In "old good time" we had to deal only with 2s Lamb shift. ...

Еще в разделе: (Показать все результаты (>168) - nuclphys.sinp.msu.ru/ )

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>75) - qilab.phys.msu.ru/ )

... Войти в систему . ... в журнале Complex Variables and Elliptic Equations , издательство Taylor & Francis (United Kingdom) , том 61, ? ... Zhikov V.V. в журнале Complex Variables and Elliptic Equations , издательство Taylor & Francis (United Kingdom) , том 56, ? ... Krutitskii P.A. , Kolybasova V.V. в журнале Complex Variables and Elliptic Equations , издательство Taylor & Francis (United Kingdom) , том 51, ? ...

Еще в разделе: (Показать все результаты (>3203) - istina.msu.ru/ )

• Inverse Problems - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Information Bulletin on Variable Stars - журнал | ИСТИНА - Интеллектуальная
• Journal of Inverse and Ill-Posed Problems - журнал | ИСТИНА - Интеллектуальная

... Various map projections are provided, with the option to draw and annotate the map boundaries. ... CYLINDRICAL PROJECTIONS : -Jc lon0 / lat0 / scale (Cassini) -Jj lon0 / scale (Miller) -Jm scale ( Mercator - Greenwich and Equator as origin) -Jm lon0 / lat0 / scale ( Mercator - Give meridian and standard parallel) -Joa lon0 / lat0 / azimuth / scale (Oblique Mercator - point and azimuth) -Job lon0 / lat0 / lon1 / lat1 / scale (Oblique Mercator - two points) -Joc ...

Еще в разделе: (Показать все результаты (>629) - xray.sai.msu.ru/ )

• http://xray.sai.msu.ru/~ivan/gmt/man/sample1d.html
• Cosmion-99
• State of the problem

... ucar.netcdf.AbstractNetcdf . ... public abstract class AbstractNetcdf . ... Create an empty instance to be populated with instances of some subclass of Variable. protected . ... Returns the set of attributes associated with this, also know as the "global" attributes. ... Returns the set of dimensions associated with this, the union of those used by each of the variables. protected void . ... Returns the set of dimensions associated with this, the union of those used by each of the variables. ...

Еще в разделе: (Показать все результаты (>98) - angel.cs.msu.su/ )

• : Interface Netcdf
• Index
• : Class Schema

... Астронет | ... Catalogue of orbits of nearby stars: Preliminary results . ... The properties of red giant stars in the solar vicinity . ... The general catalogue of variable stars: From P. P. Parenago to the present period . ... Simultaneous WBVR observations and interpretations of the light curves of TT ARI and V603 AQL . ... Spectrophotometric catalogue of the Sternberg Astronomical Institute: Observations and Astrophysical results . ... Archaeoastronomy and Aratus' phaenomena . ...

Еще в разделе: (Показать все результаты (>8746) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• T Tauri and Hind s Variable Nebula

Gol'dman N. L. Inverse problems with final overdetermination for parabolic equations with unknown coefficients multiplying the highest derivative // Doklady Mathematics. ... This paper deals with coefficient inverse problems in Holder spaces for parabolic equations with additional information specified as final overdetermination. ... Ключевые слова: Coefficient inverse problems, parabolic equations in Holder spaces, final overdetermination, uniqueness problem, duality principle, inverse uniqueness ...

Еще в разделе: (Показать все результаты (>145) - srcc.msu.ru/ )

• W. Hackbusch, B.N. Khoromskij, S. Sauter, and E. Tyrtyshnikov. Use of tensor
• D.D.Sokoloff, Magnetic field reversals in a simple model of geodynamo, Problems
• M. Li, V. Morozov, S. Piskarev. On the approximation of derivatives of

... Olga V. Kiseleva Ph.D., associate professor, Ulyanovsk State University. ... The authors study the current situation in the Ulyanovsk Region labor market. There is a review of labor market in the Ulyanovsk Region and the analysis of the labor force structure. The results of this research, as well as the calculated indicator of tension on the labor market testifies to the lack of labor force in the region and the need to take measures to address the imbalance of the labor market. ...

Еще в разделе: (Показать все результаты (>356) - ee-journal.spa.msu.ru/ )

. Alexey Rastorguev's software . Linsvd Linear least-square problem solution by singular value decompisition of matrix . Lafkin Periodogram calculation (Lafler-Kinman statistics) . FourierPeriodogram Periodogram calculation by Fourier-decomposition . Equ2gal Transformation of the equatorial coordinates and proper motions to the galactic frame . Galorbits.zip Calculation of orbits in three-component Milky Way galaxy model

Еще в разделе: (Показать все результаты (>285) - lnfm1.sai.msu.ru/ )

• Отдел Изучения Галактики и переменных звезд
• Anna Mel'nik - My Home Page
• Shugarov's Home Page

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>68) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps

... A New Method of Separation of Variables for Certain Linear Problems of Mathematical Physics . A.Shanin (Department of Acoustics, Faculty of Physics, Moscow State University, Moscow, Russia) . ... It is well known that the traditional procedure of separation of variables is deeply connected with the invariance of the differential operator with respect to a symmetry operator. ... Here we describe the method to transform the PDE boundary problem into the system of ODEs. ...

Еще в разделе: (Показать все результаты (>239) - acs366.phys.msu.su/ )

• AUTHOR : Shanin A
• Schedule : Modern Group Analysis (MOGRAN 9)

Some Explicit Formulas for Calculation of Conditional Mathematical Expectations of Random Variables and their Applications / Kambarbaeva G.S. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>318) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2010
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 4/2014

... The main problem is increasing the recognition rate of some recognition engines, working in some restricted domains, such as telephone time-table question-answer systems and so on. ... Our algorithms allow user to get recognition variants, which are right sentences in some formal language. ... We suppose that BRE can produce a set of recognition variants in the form of the "complex chain". ... Length of complex chain is the number of vertexes in its graph. ... const*n^2 . ...

Еще в разделе: (Показать все результаты (>139) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Strogalov Alexander Sergeevich
• Intelligent Systems :: Staff :: Irmatov Anvar Adhamovich
• Intelligent Systems :: Staff :: Strogalov Alexander Sergeevich :: Modeling

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 590, 591 (Head of the laboratory), 62 . The Laboratory was established in 2001 to provide teaching and research in mathematical foundations of cryptography, cryptoanalysis, information and software security. ... The Laboratory of Mathematical Problems of Computer Security is performing a thorough research on mathematical problems in cryptoanalysis, information security, and program verification. ...

Еще в разделе: (Показать все результаты (>157) - en.cs.msu.ru/ )

• Laboratory of Mathematical Problems of Computer Security
• Department of Mathematical Physics | CMC MSU
• Department of Functional Analysis and its Applications | CMC MSU

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... xslt2] error внутри variable . ... Re: [xslt2] error внутри variable [ re: Tarass ] . ... Re: [xslt2] error внутри variable [ re: vond ] . ... XSLT2 - 2.9 Error Handling : . ...

Еще в разделе: (Показать все результаты (>1623) - www.snto-msu.net/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... xslt2] error внутри variable . ... Re: [xslt2] error внутри variable [ re: Tarass ] . ... Re: [xslt2] error внутри variable [ re: vond ] . ... XSLT2 - 2.9 Error Handling : . ...

Еще в разделе: (Показать все результаты (>3247) - www.fds-net.ru/ )

• Diablo2 Server Problem (to Plop) - Public forum of MSU united student networks

XXIII ICTAM, 19­24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>46) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-134-1.pdf
• http://shamolin2.imec.msu.ru/art-102.pdf
• http://shamolin2.imec.msu.ru/art-136-1.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>31) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt
• ConClus

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>29) - hit-conf.imec.msu.ru/ )