news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>15) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

... Minimal size of Clud clusters (residues) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Hydrophobic cluster of a single protein structure is a separated pool of nonpolar atoms. Usually there is the biggest cluster in the protein called hydrophobic core. ... ConClus program is able to detect of conservative hydrophobic clusters for a family of related protein domains or just for a set of aligned proteins. ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

topology for 1 alm molecule, 128 popc lipids, water and 1 counter ion ; alm.itp can be made in a straightforward manner with pdb2gmx, starting ; with a pdb file of alamethicin . ; make sure lipid.itp , popc.itp and alm.itp are in a location where ; grompp can find them (GMXLIB, current directory , or directory given in ; the .mdp file with the include option. # include ffgmx.itp # include ...

Еще в разделе: (Показать все результаты (>3456) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_03/doc/term3/EMBnet_unix.pdf
• TracRoadmap (diff) тАУ Tanchiki
• WikiProcessors тАУ Tanchiki

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ­ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ­ Blocking: ­ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI «-» () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>7) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~ifed/teraflops/Popova_OpenMP.pdf

. Album : Фотоальбом Сергея Аюкова :: Travels to distant places and countries :: 1997/08 Japan (Kyoto, Nara) :: 18/08 Higashi-Honganji temple . Up . << Prev . Another view. Myself included. Next >> . Album created by album generator from Marginal Hacks by David Madison on Wed Jun 5 20:38:36 2013 .

Еще в разделе: (Показать все результаты (>5768) - crydee.sai.msu.ru/ )

• Long description of float and text flow example
• Background color examples
• Long description of example illustrating floating without clear

... Credit Copyright: CNSA , Chinanews , Kenneth Kremer Marco Di Lorenzo Explanation: Where has the Yutu rover been on the Moon? Arriving in 2013 mid-December, the Chinese Yutu robotic rover has spent some of the past month and a half exploring Mare Imbrium on Earth's Moon . ... Pictured above is a digitally created time-lapse composite panorama showing the region surrounding the Chang'e 3 lander , capturing the desk-sized rover in three positions. ... Comet Meets Moon and Morning Star . ...

Еще в разделе: (Показать все результаты (>8810) - www.astronet.ru/ )

• Gliese 876 System Includes Large Terrestrial Planet
• Астронет > Gliese 876 System Includes Large Terrestrial Planet
• Астронет > Lunar Time Lapse Panorama including Yutu Rover

Proposals and projects in the Coordinated Call FP7-ICT-2011-EU- Russia Information Meeting Moscow: 21st October, 2010 EU- Russia Call · First ICT Joint Call with Russia (dedicated INCO Call in WP 11-12); joint calls have already been implemented in other areas of FP7 · Russia is investing in High Performance Computing: No 12 supercomputer in the top500 list is Russian; aiming to enter Top3 already in ...

Еще в разделе: (Показать все результаты (>112) - www.msu.ru/ )

fitshdr - FITS-file headers manipulation tool fitshdr [options] [FITSfile_name] . ... fitshdr [options] --edit FITSfile_name . ... If You want to modify headers of FITSFILE using new FITS-header lines from HEADER file (or from stdin), You have to use this option (You can skip this option, if -H or --header option is used). ... Empty header lines are not displayed (in 'dump' mode only). --line-offsets . ... In 'dump' mode: file offset will be displayed for each header line. --no-line-offsets . ...

Еще в разделе: (Показать все результаты (>368) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR_EDIT
• FITShdr: FITS header viewer/editor
• ...Some useful software links...

... Supercomputer molecular modeling of thermodynamic equilibrium in gas-metal microsystems" . Podryga V.O., Polyakov S.V., and Puzyrkov D.V. This paper is devoted to the supercomputer modeling of thermodynamic equilibrium in microsystems containing different substances in various aggregate states. ... Podryga V.O. тАУ Keldysh Institute of Applied Mathematics, Russian Academy of Sciences; Miusskaya ploshchadтАЩ 4, Moscow, 125047, Russia; Ph.D., Scientist, e-mail: pvictoria@list.ru . ...

Еще в разделе: (Показать все результаты (>352) - num-meth.srcc.msu.ru/ )

• "An accelerated topology change algorithm for the contour advection method"
• "Numerical aspects of the calculation of scaling factors from experimental...
• "A quasi-3D model of a polymer electrolyte fuel cell"

... Главная -> Фильмы -> *batteries not included . ... Фильмы . ... batteries not included . ... США 1987 . ... Michael Carmine . ... Tom Aldredge . ... John DiSanti . John Pankow . ... Michael Greene . ... Angel Santana . ... Alice Beardsley . ... John Arceri . ...

Еще в разделе: (Показать все результаты (>133) - kinfo.ru/ )

• Parrot Sketch Not Included: .. - Фильмы - Kinfo.ru

. Name . Last modified . Size . Description . Parent Directory . - . DB_functions.pm . 31-Oct-2005 10:41 . 529 . dbcon.msn . 31-Oct-2005 10:41 . 602 . dump.mysql . 31-Oct-2005 10:41 . 960 . forum/ . 31-Oct-2005 10:41 . - . redirect.msn . 31-Oct-2005 10:41 . 206 . Apache/2.2.16 (Debian) Server at www.kosmofizika.ru Port 80

Еще в разделе: (Показать все результаты (>70) - www.kosmofizika.ru/ )

• Index of /includes/forum

... 2015-12-17 12:35 . 1.2K . ...

Еще в разделе: (Показать все результаты (>299) - herba.msu.ru/ )

• Index of /shipunov/school/biol_448/nd_keys/nd_compositae/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_plant_families/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_labiatae/includes

Name Last modified Size Description . Parent Directory - top.htm 01-Nov-2010 03:19 305 . Apache Server at genphys.phys.msu.su Port 80

Еще в разделе: (Показать все результаты (>21) - genphys.phys.msu.su/ )

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>421) - xray.sai.msu.ru/ )

• The X-ray Optics
• PROBLEMS OF THEORETICAL COSMOLOGY - UISS2000
• AXAF-Chandra

... 71201010 : Re: [c++] возможно ли произвольное число циклов без рекурсии? [re:ksa] 23.01.2013 13:49 | ... пределы для простоты одинаковые, только переменные цикла естественно разные, в самом внутреннем цикле все счетчики используются для вычисления некого выражения. code: . ...

Еще в разделе: (Показать все результаты (>3044) - www.fds-net.ru/ )

• MinGW + QT [Windows] траблы с include-директориями - Public forum of MSU united
• Re: На злобу дня - Public forum of MSU united student networks
• Как передать параметр в g++ к исходнику - Public forum of MSU united student

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MinGW + QT [Windows] траблы с include-директориями . ... как настроить MinGW, чтобы он меня видел? ... Re: MinGW + QT [Window] траблы с include-директориями [ re: StepLg ] . ...

Еще в разделе: (Показать все результаты (>1733) - www.snto-msu.net/ )

• iostream - Public forum of MSU united student networks
• Re: юмор в этом разделе - Public forum of MSU united student networks
• Re: На злобу дня - Public forum of MSU united student networks

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>156) - www.mmonline.ru/ )

• MMOnline | Новости | Эволюция Программиста
• MMOnline | Развлечения | Эволюция Программиста

To see a Russian version of this page, click here . ... Graduated from Moscow State University (MSU), Faculty of Physics in 1976. Ph.D. degree - 1988, MSU. Main field of scientific activities: photometric investigations of various stars, close binary stellar systems and other astronomical objects, including research with use of fast photoelectric photometry with a high time resolution till 1 millisecond. ... New portable photometer . ... Send your mail to: tem@sai.msu.ru ...

Еще в разделе: (Показать все результаты (>14) - uranus.sai.msu.ru/ )

• Irina Glushneva

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>154) - www.genebee.msu.ru/ )

• GeneBee
• GEA :: Gene Expression Analysis