O.G. Koshelev . In the last years we have developed new methods of measurement of the photoelectric parameters of silicon wafers used for solar cell fabrication. ... One of the methods permits to determine the photoelectric parameters of wafer without conductive electrodes. ... The method can be easily automatized. The methods were tested on silicon solar cells irradiated by fast particles. ... A nondestructive method for measuring the photoelectric parameters of wafers with p-n-junctions. ...

Еще в разделе: (Показать все результаты (>89) - scon155.phys.msu.su/ )

• A new method for determining parameters of the potential well of off-center

Foswiki defines some standard special tokens that can be used to replace characters in some parameters - notably those to FormattedSearch and IfStatements - to defer evaluation of the parameter until later. ... New line. Use $n() if followed by alphanumeric character, e.g. write Foo$n()Bar instead of Foo$nBar Most macros accept parameter strings which are split over multiple lines. ... dollar . Dollar sign ( $ ) . ... This topic: System > WebHome > Macros > FormattedSearch > FormatTokens . ...

Еще в разделе: (Показать все результаты (>6652) - wiki.cmc.msu.ru/ )

• PerlDoc < System < Foswiki
• IncludeTopicsAndWebPages < System < Foswiki
• (backlinks in System Web) FormattedSearch < System < Foswiki

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>37) - erg.biophys.msu.ru/ )

... Perturbation Theory has a long tradition. ... The stability of an equilibrium (or periodic) state of a system depends in the first instance on the eigenvalues of the system linearized about that state. ... After an introductory chapter on stability theory, a long Chapter 2 deals with bifurcation analysis of eigenvalues of matrices depending on several parameters: this is the core of the book on which most of the rest depends. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

... Data . ... Models . Solar energetic particles . Paraboloid model . ... Neutron flux variations (RU) . ... This program package is intended to prognose the environment on the board of near-earth elliptic orbiting satellites in the open space as well as behind the Al shielding. ... Next is the required spectrum type (integral or differential). ... sp_x.txt - solar proton spectrum behind shielding, fluence . sn_x.txt - solar neutron spectrum behind shielding, fluence . ... Solar . ...

Еще в разделе: (Показать все результаты (>38) - smdc.sinp.msu.ru/ )

• Paraboloid model of the Earth's magnetosphere - Space monitoring data center
• APEV service - Space monitoring data center
• Space monitoring data center

... A sample invocation for the Ethernet interface eth0 may look like this: # ifconfig eth0 eth0 Link encap 10Mbps Ethernet HWaddr 00:00:C0:90:B3:42 inet addr 191.72.1.2 Bcast 191.72.1.255 Mask 255.255.255.0 UP BROADCAST RUNNING MTU 1500 Metric 0 RX packets 3136 errors 217 dropped 7 overrun 26 TX packets 1752 errors 25 dropped 0 overrun 0 The MTU and Metric fields show the current MTU and metric value for that interface. ... If a broadcast address has been set, ifconfig displays the BROADCAST flag.) . ...

Еще в разделе: (Показать все результаты (>449) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• mod_ext_filter - Apache HTTP Server
• Defining the Local Mailer

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>5) - vserv.sinp.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>24) - curl.sai.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

Predictor of DVM-program performance . User's guide . ... With the predictor user can get the predicted time characteristics of execution of his program on MPP or workstation cluster in more or less details. The predictor is the system for processing the trace information gathered by DVM-program Run-Time system (Lib-DVM library) during the program execution on a workstation and consists of two major components: trace interpreter ( PRESAGE) and time estimator (RATER). ... Program execution. ...

Еще в разделе: (Показать все результаты (>125) - sp.cs.msu.ru/ )

• Prefictor of DVM-program performance. Preliminary design
• Lib-DVM. Detailed design
• Lib-DVM. Preliminary design

... Fig.1 shows the results of spectra calculations for theoretical ARS diagrams of pole - dipole (1) and dipole equatorial (2) arrays above anisotropic half-space with longitudinal and transversal resistivities equal to 1 and 3. ... The spectrum for AMN array (1) has maximum at zero harmonic (which reflect mean resistivity of the medium), while the second and the next even harmonics are much smaller. ... That is why D array is much more sensitive to anisotropy in comparison with any linear array. ...

Еще в разделе: (Показать все результаты (>68) - geophys.geol.msu.ru/ )

• TES. Median algorithm

You are here: Foswiki > System Web > ReferenceManual > UserDocumentationCategory > IncludeTopicsAndWebPages (revision 1) E dit A ttach . The %INCLUDE{...}% macro embeds the content of the specified topic at the place where the INCLUDE is used. The whole content or only parts of of a page can be included. ... On this page: . Syntax Example . ... Include a topic . ... INCLUDE{ "page" pattern="reg-exp" rev="2" warn="off" section="clients" PARAMETER1="value" PARAMETER2="Some value" }% . ...

Еще в разделе: (Показать все результаты (>2164) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) FormattedSearch < System < Foswiki
• (backlinks in System Web) FormattedSearch < System < Foswiki
• VarQUERYPARAMS < System < Foswiki

diploma thesis abstract of Zjabko I.A. Anisotropy of a parameter of absorption in thin films of polymer polyparaphenilvenylene and donor-acceptor compositions on its basis In the present work are investigated thin a film of the connected polymer of a soluble derivative polyparaphenilvenylene (PPV). ... The received experimental curves are approximated by theoretical dependence and thus required values of optical constants are determined. ...

Еще в разделе: (Показать все результаты (>168) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Kostryukov_Tunkin_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2010/Yagnyatinskiy_Konovko_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Makarova_Nazarov_en.pdf

DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...

Еще в разделе: (Показать все результаты (>8) - dbserv.sinp.msu.ru/ )

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>59) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/ZnS_FeS.doc
• Download Yuri Shvarov's files

... 2004). Our attempt to increase the yield in the reaction of O-methylation (Albov, Rybakov et al., 2004), using excess methyl iodide, caused the subsequent methylation at the N atom and led to the title compound, (2) (Fig. ... C10H13NO DOI: 10.1107/S1600536804010025 Acta Cryst. ... ORTEP 3 (Farrugia, 1997) view of (2), with the atom numbering scheme. ... Acta Cryst. ... Farrugia, L. J. (1997). ... Cryst. ... In (2), H atoms were included in calculated positions and re®ned as riding atoms. ...

Еще в разделе: (Показать все результаты (>141) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/091e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/098e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/100e.pdf

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>52) - cosmos.msu.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>31) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

D.Sokoloff, Long-term dynamics of solar cycle, geomagnetic reversals and fluctuations of dynamo governing parameters, European Geoscience Union, General Assembly, Vienna, 2012, EGU2012-1514, p.1514). As a matter of fact, cyclic behavior of solar activity demonstrates a dynamics on the timescales which are much longer then the cycle period. ... A model which relate such phenomena with random variations of alpha-effect (or other governing mean-field dynamo parameters) is suggested. ...

Еще в разделе: (Показать все результаты (>101) - srcc.msu.ru/ )

• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff,
• V.V.Pipin, D.D.Sokoloff, I.G. Usoskin, Variations of the solar cycle profile in