... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>10) - bioinf.fbb.msu.ru/ )

• SDPlight
• Input Formats
• SDPpred

... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>107) - scon155.phys.msu.su/ )

• First-principles calculations of physical properties of crystals
• New methods of measuring photoelectric parameters of silicon
• Theory of electronic properties of disordered semiconductors and systems with

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>26) - curl.sai.msu.ru/ )

... 3D magnetosphere . ... Data . ... Magnetosphere . ... Magnetic field at the selected point Module of the Magnetic field distribution along Sun-Earth line Noon-Midnight magnetosphere structure . ... Point coordinates, where magnetic field will be calculated: . ... Magnetic field at MD outer edge . ... Magnetic field at TC inner edge . ... Distance to external edge of MD . ... Distance to inner edge of MD . ... Magnetopause stand-off distance . ... Distance to inner edge of geotail current sheet . ...

Еще в разделе: (Показать все результаты (>98) - swx.sinp.msu.ru/ )

... The Radon transform (also known as the Hough transform) is formulated as a family of line integrals through a two-dimensional function. ... The Radon transform provides us with a simple means of computing the FF plane of the autochirplet transform, by using the Wigner distribution, and arriving at a transform space that tells us basically the same information as the chirplet FF-plane, except that we benefit from the greater resolution of the Wigner distribution. ...

Еще в разделе: (Показать все результаты (>4081) - crydee.sai.msu.ru/ )

• Tutorial on Fortran 90, Digital UNIX
• The pyramidal (multi-resolution) CCT
• Gaussian Chirplet Transform (GCT)

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>36) - smdc.sinp.msu.ru/ )

• COSRAD model - Space monitoring data center
• Scientific services - Space monitoring data center

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>166) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• View publication | Laboratory of Mathematical Methods of Image Processing

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

... Online Services | ... CDFE => Online Services => Chart of Nucleus Shape Parameters . Nucleus quadrupole deformation parameter ? ... At.Data Nucl.Data Tables 78, 1 (2001)] . ... N.J.Stone, At.Data Nucl.Data Tables, 90 75 (2005)] . ... Nucleus charge radii: . ... Nadjakov E. G., Marinova K. P. and Gangrsky Y. P., At.Data Nucl.Data Tables, 56, 133(1994)] (updated 2015) . ... I. Angeli, At.Data Nucl.Data Tables, 87, 185 (2004), updated 2008] . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>35) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>55) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• MSU-LGCLL:: Papers submitted to QUALICO-94
• Large transportation networks with finite-dimensional state space. Asimptotic

... Лаборатория теоретической биофизики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>57) - erg.biophys.msu.ru/ )

• topology ERG Research Group: Лаборатория теоретической биофизики
• comcon1 ERG Research Group: Лаборатория теоретической биофизики
• OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория

. G. P. Shpenkov, L. G. Kreidik. Conjugate Parameters of Physical Processes and Physical Time (PDF-file, 370 Kb) [distributed 25.10.2009] . G. P. Shpenkov, L. G. Kreidik. Dynamic Model of Elementary Particles and Fundamental Interactions (PDF-file, 240 Kb) [distributed 05.10.2009] . Web-сайт: http://shpenkov.janmax.com/ . E-mail: .

Еще в разделе: (Показать все результаты (>580) - chronos.msu.ru/ )

• Крейдик Л.Г. (L. G. Kreidik)
• O.S.Razumovsky. Models of Time in Physics and Cosmology

Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff, A.Pevtsov, Magnetic helicity of solar active regions as revealed by vector magnetograms and coronal X-ray images, Publ. Astron. ... Japan, 64, 54, 12 pages, 2012. We have used photospheric vector magnetograms of 15 different solar active regions to calculate the current helicity parameter, ?av, and the linear force-free field (LFFF) parameter, ?best, that fits best the observed transverse field. ...

Еще в разделе: (Показать все результаты (>108) - srcc.msu.ru/ )

• D. Chechin, C. Luepkes, I. Repina. Mesoscale modelling of an off-ice flow in

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>235) - lnfm1.sai.msu.ru/ )

• Scientific activity
• IMCCE-SAI: Natural Satellites Data Center (NSDC). Parameters
• IMCCE-SAI: Natural Satellites Service. Parameters and constants

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Vishnevskiy Yury V. , Tikhonov Denis . ... Vogt N. , Vishnevskiy Y.V. , Ivanov A.A. , Vogt J., Vilkov L.V. в журнале Russ. ... Dorofeeva O.V. , Vishnevskiy Y.V. , Moiseeva N.F. в журнале Structural Chemistry , издательство Springer-Verlag (Heidelberg, Germany) , том 17, ? ...

Еще в разделе: (Показать все результаты (>2855) - istina.msu.ru/ )

• Montuoro R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Liu X.J. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Morishita Y. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Li Yan, et al. ... 112 (2014) 08230, Universal fluctuation-driven eccentricities in proton-proton, proton-nucleus and nucleusnucleus collision Li Yan, J.-V. Ollitrault, A.M. Poskanzer ,Phys.Rev. C90 (2014) 2, 02490, arXiv:1405.6595 Eccentricity distributions in nucleus-nucleus collisions Li Yan, J.-V. Ollitrault, A.M. Poskanzer Phys.Rev.Lett.B742(2015)290 Azimuthal Anisotropy Distributions in High-Energy Collisions , 3 (), 13.30, 2015 ., ... Li Yan, J.-V. Ollitrault, A.M. Poskanzer Phys.Lett. ...

Еще в разделе: (Показать все результаты (>56) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/vlk_03.03.15.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/ZZlav01_seminar.pdf
• http://lav01.sinp.msu.ru/~vlk/pp_coll_ppt_16May_report.pdf

... This work is aimed at Monte-Carlo analyzing the energy-angle distributions of fast protons reflected from a steel surface and at comparing theory and experiment [1,2]. cade initiated by ion bombardment [10,11] and in the collisions of ions with foil [12]. ... The projectile ion energy decreases in each collision. ... The parameter Emax ?hо that characterizes the energy at which the reflected proton energy distribution in collisions with the steel surface at a small angle a М 4А is peaking. ...

Еще в разделе: (Показать все результаты (>107) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Tulinov_85/NIMB267(2009)2592-AFT.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_sputteryield_sizeclasterion.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevA56_1997_2848NMKab.pdf

... New parameter parsing API: This chapter documents the new Zend parameter parsing API introduced by Andrei Zmievski. ... It greatly simplifies the process of receiving parameteres, but it has a drawback in that it can't be used for functions that expect variable number of parameters. ... The third argument is a string that specifies the number and types of arguments your function is expecting, similar to how printf format string specifies the number and format of the output values it should operate...

Еще в разделе: (Показать все результаты (>684) - oit.cmc.msu.ru/ )

• Dealing with a Variable Number of Arguments/Optional Parameters
• Assuring Write Safety for Other Parameters
• BCMath Arbitrary Precision Mathematics Functions

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )