... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

... Женский клуб . ... Издательство МГУ . ... МГУ им.Ломоносова . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... AGEXPERTT RX CODE - первый антивозрастной продукт специально для мужчин, повышающий физическую, умственную и сексуальную активность, замедляющий процесс старения. ... AGEXPERTT RX CODE - биологически активная добавка к пище для повышения мужской активности и коррекции возрастных изменений. ... В течение многих веков это растение использовалось для повышения потенции и сексуальной силы мужчин. ...

Еще в разделе: (Показать все результаты (>201) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: AGEXPERT SX CODE антивозрастной секс тоник
• Клуб выпускников МГУ: Петр Митричев, победитель Google Code Jam: 'Слава
• Клуб выпускников МГУ: Объявлен победитель Google Code Jam

Secondary structures in the coding regions of mRNAs: literature survey and comparison of prediction methods Aleksandra Vasileva3, Michael Kiening1, Dmitrij Frishman1, 1 2,3 Department of Bioinformatics, Technische UniversitДt MЭnchen ... 195251 , Russia, aleksandra.vasileva.spbpu@gmail.com mRNA molecules contain three main domains ­ 5'UTR (untranslated region), CDS ( coding region), and 3'UTR ... One of the options in this case is to compute the distance between two RNA structures. ... Fig. ...

Еще в разделе: (Показать все результаты (>89) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/125.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/225.pdf

... QR Codes: Not for Human Eyes . ... 4.10.2011 . ... Credit Copyright: Kaywa QR Code Generator (Free) Explanation: This communication was not meant for human eyes. ... Sometimes the deciphered code will reveal a web site address, prompting the smartphone to then ask you if you want to access this address to learn more about the object. ... Although not meant to communicate with aliens , QR codes employ several attributes common to famous alien communication attempts. ... October 2011 . ... 2011 2012 ....

Еще в разделе: (Показать все результаты (>2131) - www.astronet.ru/ )

• Астронет > QR Codes: Not for Human Eyes
• Universe Age from the Microwave Background
• Астронет > Universe Age from the Microwave Background

Old serial MP2 gradient code, running in full compatibility with GAMESS (US) serial MP2 gradient code mode . Old serial MP2 gradient code, PC GAMESS specific version . New MP2 gradient code, running on single core of four-core system . New MP2 gradient code, running on all four cores of four-core system . ... Press to visit PC GAMESS v. 7.1 parallel MP2 gradient code benchmark and scalability on Gigabit Ethernet Windows cluster page . ... Press to visit PC GAMESS' Woodcrest vs. ...

Еще в разделе: (Показать все результаты (>97) - classic.chem.msu.su/ )

• PC GAMESS v. 7.1 parallel MP2 gradient code benchmark and scalability on
• PC GAMESS/Firefly standard MCQDPT2 benchmark (using resolvent fitting code)
• Firefly/PC GAMESS DOCUMENTATION - LARGE SCALE MCQDPT2 and XMCQDPT2

... Sbjct : 4697 gtagaattaatcgctgcgatggaagaaaaatttggtgtttc 4657 Database : all Posted date: Oct 28, 2008 10:42 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 47,271 Number of extensions: 3044 ...

Еще в разделе: (Показать все результаты (>2730) - kodomo.cmm.msu.ru/ )

• searching of the RNA-coding genes in other organizm
• Help: Index
• Functions, their classification and enzyme codes.

. The Source Code Control System is an essential tool for any project with multiple source files or which has several people working with multiple source files. It provides a way to keep track of a source file's development and to prevent it from being altered by more than one person at a time. Putting files under SCCS control . Checking out files . Checking in files . Getting information about files . Creating new releases . Comparing files under SCCS control .

Еще в разделе: (Показать все результаты (>95) - comet.sai.msu.ru/ )

• UNIXhelp Glossary - "A"
• Special Characters

This is possible if you do it in the following way, that is if you use the new continuation sign "&" at the end of the old line, but in position 73 so that it doesn't conflict with Fortran 77, and also choose the "&" sign as the almost arbitrary character in column 6, in order to get continuation according to Fortran 77. ... Comments are an incompatibility problem between Fortran 77 and Fortran 90, but of course not between fixed and free forms of Fortran 90 since the "!" is permitted in both. ...

Еще в разделе: (Показать все результаты (>1255) - crydee.sai.msu.ru/ )

• Index of /f90/code
• Index of /ftproot/pub/comp/hardware/NCR/samp_code
• Index of /ftproot/pub/comp/hardware/NCR/samp_code/TOOLS

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Другие названия журнала: Designs, Codes and Cryptography . ... Anashin V. , Khrennikov A. , Yurova E. в журнале Designs, Codes, and Cryptography , издательство Kluwer Academic Publishers (Netherlands) , том 71, ? ...

Еще в разделе: (Показать все результаты (>179) - istina.msu.ru/ )

• Source Code for Biology and Medicine - журнал | ИСТИНА - Интеллектуальная
• Martinez C. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Gonzalez S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Proceedings 2009 . Proceedings 2008 . Proceedings 2007 . Proceedings 2006 . Proceedings 2005 . Proceedings 2004 . ... The code DYNAMICS [1] for modeling of wide class non-idial systems in frame of the method of classical molecular dynamics was created by authors. The code is provided with friendly interface and advanced facilities of graphical presentation of results of compulational experiments. 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>29) - www.mce.biophys.msu.ru/ )

• The code "Prometheus" for computational experiments with the lattice systems of
• Books : Пародия и стиль. О романе Дэна Брауна "Код Да Винчи" и двух пародиях на

... Программа Google Summer of Code 2008 . Программа Google Summer of Code 2008 создана для привлечения студентов к участию в разработке программного обеспечения с открытым исходным кодом. ... Работая с несколькими группами, которые занимаются ПО с открытым исходным кодом, свободным программным обеспечением и технологиями, Google сможет найти и профинансировать ряд проектов в течение трех месяцев. ... Компания Google приглашает студентов присоединиться к ее программе. ... Обновлено: 18.3.2008 ...

Еще в разделе: (Показать все результаты (>86) - sp.cs.msu.ru/ )

• Fortran DVM compiler. Detailed design
• DVM-system - copyright
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

This module provides for loading of executable code and modules into the server at start-up or restart time. ... On Windows, mod_dll was used in beta release 1.3b1 through 1.3b5. mod_so combines these two modules into a single module for all operating systems. ... Because Apache for Windows does not have the Configure program of Apache for Unix, the module's source file must be added to the ApacheCore project file, and its symbols must be added to the os\win32\modules.c file. ... Module: mod_so . ...

Еще в разделе: (Показать все результаты (>102) - neptun.sai.msu.ru/ )

• Apache module mod_dld
• Configuring Multiple IP Addresses
• Apache 1.3 Dynamic Shared Object (DSO) support

Canadian Paper Money] љ [Canadian Paper Money - Questions & Answers] . ... a) a current bank-note or current paper money, or . ... a) all or part of a current bank-note or current paper money, or . ... b) except for the word "Canada", nothing having the appearance of a word, letter or numeral was a complete word, letter or numeral; . ... e) nothing in the likeness or appearance of the back of a current bank-note or current paper money was published or printed in any form. ...

Еще в разделе: (Показать все результаты (>308) - xray.sai.msu.ru/ )

• Scenario Machine Engine: Credits
• No Title
• SIMBAD: Object list from refcode

... Development of AIG Life products distribution within the partner\'s sales channels to ensure effective sales growth and appropriate quality of business . Plan and implement actions for accounts to deliver the sales targets . ... Insurance or financial retail industry experience . Minimum 1 year sales experience in managing accounts (banking retail preferred) . ...

Еще в разделе: (Показать все результаты (>31) - www.physcareer.ru/ )

• Direct Marketing Manager (Code - "DM/2007") / Вакансии / Physcareer.ru
• Более 100 вакансий от компании Samsung / Вакансии / Physcareer.ru

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . Институт проблем экологии и эволюции им. А.Н. Северцова РАН . Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Cambridge Satchel Discount Code Sale pKwP . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>601) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: odxxn alexander wang promo code

# R functions for recoding # Alexey Shipunov, dactylorhiza@gmail.com # v. 20150714 # === # # Multiply recoding # # if starting points ("from") are the same, only _last_ rule ("from-to" pair) has an effect # if rules are chained, they still work independently (i.e., chaining has no effect) # Recode

Еще в разделе: (Показать все результаты (>54) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/knapweed/chondrilla_juncea_2006.pdf

... Поиск по МГУ | ... Выпускник механико-математического факультета МГУ стал победителем Russian Code Cup . ... Победителем стал выпускник механико-математического факультета МГУ имени М.В. Ломоносова Петр Митричев из Москвы. ... В 2006-2007 гг., еще будучи студентом механико-математического факультета МГУ, он дважды победил в студенческом чемпионате мира по программированию TopCoder Collegiate Challenge в США, а в начале 2011 г. стал победителем 'Хакерского кубка Facebook' (Facebook Hacker Cup). ...

Еще в разделе: (Показать все результаты (>37) - www.msunews.ru/ )

• MsuNews.Ru
• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта

... FYI -------- Forwarded Message -------- Subject: [Noc-managers] [ Heads up][ EGI SVG/ CSIRT ] [ EGI-ADV-20150105 ] EGI CSIRT alert 'High' Risk - CVE-2014-9295 - Remote code execution in NTP - [ EGI-ADV-20150106 ] Date: Wed, 07 Jan 2015 17:39:30 +0100 From: Sven Gabriel sveng at nikhef.nl To: site-security-contacts at mailman. egi .eu , ngi-security-contacts at mailman. egi .eu CC: noc-managers at mailman ... 2014-12-19 Agreed not critical for EGI, therefore no urgent action. ...

Еще в разделе: (Показать все результаты (>1264) - theory.sinp.msu.ru/ )

• lcn:f8 [THEP]
• тЬО fc3:dokuwiki:example [THEP]
• [RU-NGI] Fwd: NGI Russia unresponsive

LENCA-2, Kazan, May 2004 IS THERE CASE IN HEAD-MARKING LANGUAGES? ... confusions in the realm of clause structure, including: o the well-known misconception of the elementary and universal character of syntactic statuses o the euro-centric underestimation of pronominal arguments · Here I point to one more misconception: the popular glossing of verbal morphological positions in head-marking languages in terms of syntactic statuses · The distinction of role coding and syntactic ...

Еще в разделе: (Показать все результаты (>103) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~slavphil/books/jsk_49_03van.pdf

Online Services | ... Research) IPN(Institute Physics Nuclear, Paris) ISN(Institute Science Nuclear, Grenoble) JINR(Joint Institute Nuclear Research) JUL-Spez(Institute fur Kernphysik) JYFL(University Jyvaskyla, Finland) LA(Los Alamos Science Laboratory) LBL(Lawrence Berkeley Laboratory) NEANDC(Nuclear Data Committee) ORNL(Oak Ridge National Laboratory) UTTAC(University Tsukuba Center) ZFK(Zentralinstitut fur Kernforschung) **************************************************** Other Code . ... Code: . ...

Еще в разделе: (Показать все результаты (>16) - cdfe.sinp.msu.ru/ )