... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2202) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... Botvinkin A.D., Kuzmin I.V., Chernov S.M. (1992). ... Kuzmin I.V., Orciari L.A., Arai Y.T., Smith J.S., Hanlon C.A., Kameoka Y., Rupprecht C.E. (2003) Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. ... Shankar V., Orciari L.A., De Mattos C., Kuzmin I.V., Pape W. J., O'shea T. J., Rupprecht C.E. (2005) Genetic divergence of rabies viruses from bat species of Colorado, USA. ... Kuzmin I.V., Rupprecht C.E. (2007) Bat rabies. ...

Еще в разделе: (Показать все результаты (>5656) - zmmu.msu.ru/ )

• Ichthyology
• Invertebrates
• Breeding bird atlas of European Russia

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>353) - graphics.cs.msu.ru/ )

• Grants and contracts | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• The Microsoft Machine Learning and Intelligence School will take place in Saint

. raguzova sai.msu.ru . (095) 939-50-06 . Last update on 16th February 2006

Еще в разделе: (Показать все результаты (>699) - xray.sai.msu.ru/ )

• Be/X-ray binaries and candidates
• Константин Александрович Постнов
• Seminars

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>267) - en.cs.msu.ru/ )

• Department of System Programming | CMC MSU
• Laboratory of Industrial Mathematics | CMC MSU
• Laboratory of Computational Practice and Information Systems | CMC MSU

... February 1992 SNMP over IPX Status of this Memo This memo provides information for the Internet community. ... Abstract This memo defines a convention for encapsulating Simple Network Management Protocol (SNMP) [1] packets over the transport mechanism provided via the Internetwork Packet Exchange (IPX) protocol [2]. ... This memo addresses the use of SNMP over the IPX protocol, which has become quite widespread principally due to the popularity of Novell NetWare. ... 2] Novell, Inc., ...

Еще в разделе: (Показать все результаты (>20547) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1298.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc807.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc807.txt

... Staff . ... Ph.D. (Candidate of Physics and Mathematics) . Researcher of Laboratory of Computer Physics of Department of Theoretical Physics at UdSU . ... 2012: Thesis of Ph.D. (candidate of science). Thesis title: Computer modelling of the systems with plenty degree of freedom and the problems of vortex dynamics Moscow Engineering Physics Institute . ... Dynamics of ideal fluid and vortex structures; . ... Rigid body dynamics; . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>221) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Borisov Alexey V
• Institute of Computer Sciences - Staff - Kozlov Valery Vasilevich
• Institute of Computer Sciences - Staff - Mamaev Ivan Sergeevich

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>523) - oit.cmc.msu.ru/ )

• History of PHP and related projects
• Security
• History of PHP related projects

Astronomy Picture of the Day . A Complete Aurora . ... 2.04.1997 . ... April . ... April 1997 . ... 1995 1996 . 1997 1998 . ... NASA Web Site Statements, Warnings, and Disclaimers . NASA Official: Jay Norris. ... A service of: LHEA at NASA / GSFC . ... U. Based on Astronomy Picture Of the Day ...

Еще в разделе: (Показать все результаты (>27260) - www.astronet.ru/ )

• Space Station Mir Over Earth
• A Complete Solar Cycle from SOHO
• Journal "Peremennye Zvezdy"

... Полная версия этой страницы: Software Developer . Студенческий форум Физфака МГУ > Общий > Работа . Anastasiya . ... BroadVision QuickSilver enables you to create and publish lengthy, complex documents in multiple output formats (including HTML, PDF and Postscript) and automates publishing of personalized content to BroadVision Portal. Assemble publications from a variety of text, graphic and database sources, including Microsoft Word, AutoCad, Microsoft Excel, and Oracle. ...

Еще в разделе: (Показать все результаты (>1473) - wasp.phys.msu.ru/ )

• Software Developer - Студенческий форум Физфака МГУ

. Welcome . to . Crimean Laboratory . of . Sternberg Astronomical Institute . Brief history . Here you may find email address (Internet) of staff at Crimean Laboratory or search database of email addresses of astronomical people over the world (last updated 15-Jan-1996). Collection of Network References ( This page has been kindly given by O. Bartunov - original version lives here ) . Net Search . Some views from Crimean Observatory of SAI . Questions and comments to webadmin@sai.crimea.ua

Еще в разделе: (Показать все результаты (>170) - comet.sai.msu.ru/ )

• Rudnitskij Georgij M. Home Page
• Filename completion with the Korn shell
• Filename completion

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>6310) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/FBB/year_05/term4/KEGG.pdf
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt

... Four classic Doom levels complete with all three keys, traps, secret doors, and of course, lots of targets. ... Play Information * Episode and Level #s : E2M1, E2M2, E2M3, E2M4 ported to Doom 2 Single Player : Yes Cooperative 2-4 Player : Yes Deathmatch 2-4 Player : Yes Difficulty Settings : Yes New Sounds : Yes (not much added since MAKDOOM1) New Graphics : Yes (only "titles" since MAKDOOM1) New Music : No Demos Replaced : No (removed...see revision history) * Construction * Base : None.. ...

Еще в разделе: (Показать все результаты (>5363) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/os/os2/leo/doc/ldevco.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/a-c/chaosbt2.txt
• V.A.Baturin - Home Page at Sternberg Astronomy Institute, MSU

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

How To Register to Use SciFinder® Introduction SciFinder's web-based user registration form allows you to create your own SciFinder username and password. The URL for the form is provided by your institution's SciFinder administrator or librarian. ... After you submit the form, CAS sends you an e-mail message with instructions for completing the registration process. ... A message indicates that you will receive an e-mail message from CAS at the address you provided within the form. ...

Еще в разделе: (Показать все результаты (>1103) - chem.msu.ru/ )

• Department of Chemistry, Moscow State University
• DIVISION OF CHEMICAL KINETICS
• Elena N. Golubeva

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>35) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

An international conference entitled "Flowers: diversity, development and evolution" will be held at the Institute of Systematic Botany, University of Zurich, Zurich, Switzerland, 5-7 July 2002. The conference will focus on the structure of flowers, placing them in context with their evolutionary origin, function, development and genetic control. ... Flowers: diversity, development and evolution 5-7 July, 2002 Institute of Systematic Botany, The University of Zurich, Zurich, Switzerland . ...

Еще в разделе: (Показать все результаты (>552) - herba.msu.ru/ )

• INTERNATIONAL SYMPOSIUM