... HTTP . HTTP: A Protocol for Networked Information. This document is available at http://www.w3.org/WWW/Protocols/HTTP/HTTP2.html . ... SGML . ... The source is available at ftp.ifi.uio.no/pub/SGML/SGMLS . ... Available by anonymous FTP as Postscript ( info.cern.ch/pub/www/doc/url.ps ) or text ( info.cern.ch/pub/www/doc/url.txt ) . ... The World-Wide Web , a global information initiative. For bootstrap information, telnet info.cern.ch or find documents by ftp://info.cern.ch/pub/www/doc . ...

Еще в разделе: (Показать все результаты (>240) - comet.sai.msu.ru/ )

• MicroEMACS Quick Reference
• rtftohtml Users Guide - 4 Special Processing
• Using Guest FTP

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

Help www.sciencedirect.com www.sciencedirect.com R www.sciencedirect.com , ScienceDirect. , (licensed user). ... R PAGE 1 OF 9 www.sciencedirect.com Quick Search, Journals, Books, Reference Works and Abstract Databases Quick Search ( ), Journals (), Reference Works ( ), Books ( ) Abstract Databases ( ). Quick Search ( ) - , . ... ProCite, EndNote Reference Manager). 3a 3a R PAGE 8 OF 9 www.sciencedirect.com 1 Alerts ( ) , , : I Search Alerts ( ); I Journals Issue Alerts ( ); I Citation Alerts ( ). ...

Еще в разделе: (Показать все результаты (>8) - wwwlib.phys.msu.ru/ )

... Identities = 27/91 (29%), Positives = 44/91 (48%) Frame = +2 Query : 9 RFAPSPSGELHFGSLIAALGSYLQARARQGRWLVRIEDIDPPREVPGAAETILRQLEHYG 68 RF P P+G LH G + ++ A QG +R +D +P +E ++I + +E G Sbjct : 3014 RFPPEPNGYLHIGHAKSICLNFGIAEDYQGLCNLRFDDTNPVKEDVEYVDSIKQDVEWLG 3193 Query : 69 LHWDGDVLWQSQRHDAYREALAWLHEQGLSY 99 W+G+ + S D L E+GL+Y Sbjct : 3194 FKWEGEPRYASDYFDQLYGYAIELIEKGLAY 3286 Database : pm Posted date: Oct 28, 2009 6:14 PM Number of letters in database : 2,269,587 ...

Еще в разделе: (Показать все результаты (>13074) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~xedin/Term2/Practice3/srs_tables.doc

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>404) - herba.msu.ru/ )

• BIOL 310: Ethnobotany

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>23) - comphep.sinp.msu.ru/ )

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>70) - smdc.sinp.msu.ru/ )

... Problems and tasks of the research programme< . ... Laboratory-chair of modelling the natural references of time . ... To indicate the natural references of time and to discuss the consequences of their existence is one of the important tasks of the research programme suggested. ... The equations of motion, representing the basic content of a dynamical theory, are actually a description of the variability objects of interest for the researcher as compared with reference variability (the clocks). ...

Еще в разделе: (Показать все результаты (>504) - chronos.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4918) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE Activities
• CDFE provides the major photonuclear databases. Online Services.

... Detailed information about each program can be found in the separate manual pages. blockmean L2 (x,y,z) data filter/decimator blockmedian L1 (x,y,z) data filter/decimator blockmode Mode (x,y,z) data filter/decimator filter1d Filter 1-D data sets (time series) fitcircle Finds the best-fitting great circle for a set of points gmtconvert Convert between ASCII and binary 1-D ... Wessel, P., and W. H. F. Smith, 1991, Free Software Helps Map and Display Data, EOS Trans., ...

Еще в разделе: (Показать все результаты (>414) - xray.sai.msu.ru/ )

• SIMBAD: Object list from refcode
• Be/X-ray binaries and candidates
• References

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>72) - engineering.phys.msu.ru/ )

• Circuit Diagnostics
• FPGA Design
• Parallel Programming

... About lab . ... Roadway video passport systems are widely-used for detailed road mapping which allows roadway quality monitoring and repair planning. ... Typical roadway images are strongly differed to each other in colors and texture, some examples are shown below. ... When preprocessing is completed our algorithm is trained on a part of rectified road image with the help of user input. ... We take advantage of image segments classification for object detection on road images. ... Source image . ...

Еще в разделе: (Показать все результаты (>330) - graphics.cs.msu.ru/ )

• Road monitoring | Лаборатория компьютерной графики и мультимедиа
• Detection of multiple object instances using Hough transform | Graphics and
• Subjective Assessment of Video Quality (MSU PVQ tool) | Graphics and Media Lab

... Home :: History of Research :: Experimental and theoretical investigations of nucleation and crystal growth processes The microcinematographic innvestigations of dislocation growth and the growh morphology of crystals were performed for the first time in 50s by Prof. G.G. Laemlain and his collaborators. ... Growth of Crystals, v.20, Consultants Bureau, 1996, pp.153-169 Home :: History of Research :: Experimental and theoretical investigations of nucleation and crystal growth processes . ...

Еще в разделе: (Показать все результаты (>145) - polly.phys.msu.ru/ )

Moscow State University Geological Faculty, Department of Geophysics . ... The signs of distortions on VES data and their role for data interpretation . ... TES field technology . ... Data processing and interpretation . ... Data visualization for TES technology. ... Field example. ... In MSU this technology appeared in 1991. ... TES modification consists of the four interconnected technologies: field measurements, data processing, visualization and interpretation. ... E-mail: sh@geophys.geol.msu.ru . ...

Еще в разделе: (Показать все результаты (>66) - geophys.geol.msu.ru/ )

• TES. Conclusion

BNL PREPRINT BNL­QGS­98­0501 Study of Ї pp Baryon Exchange Processes V. L. Korotkikh 1;2 June 25, 1998 abstract The cross­section of the process Ї p + p ! ... ъ + + ъ \Gamma We repeated Barger and Cline's [3] calculation of reaction (3) and received the same 2 results at 10 GeV with their parameters: fi \Delta 8ъ = 0:10 GeV \Gamma1 ; s 0 = 2:85 GeV 2 ; ff \Delta (u) = 0:15 + 0:9 u: (5) The differential cross­section depends on these parameters as dЇoe du = 389:3 Їb ъ 2 s / fi \Delta 8ъ ! ...

Еще в разделе: (Показать все результаты (>44) - lav01.sinp.msu.ru/ )

Computer tool for gene expression data processing and correlation analysis Anastasia M. Spitsina, Novosibirsk State University, 630090, Novosibirks, 2 Pirogova Str. , anastasia.spitsina@gmail.com Natalya ... databases (BioGPS (http://biogps.org/), GEO NCBI (http://www.ncbi.nlm.nih.gov/geo/)) has accumulated a large body of experimental data obtained using DNA microarrays ... So the aim of this work was to develop and improve own program for data processing and analysis of gene expression. ...

Еще в разделе: (Показать все результаты (>241) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/216.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/96.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/237.pdf

Chair of General Physics and Wave Processes, Physics Faculty of MSU . ... Science and education . ... Scientific Laboratories . ... Science . ... Education . 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... Main Science and education Scientific Laboratories Laboratory of ultrafast processes in biology . ... All laboratory`s grants . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>704) - ofvp.phys.msu.ru/ )

• Сайт кафедры общей физики и волновых процессов

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

LangueDOC . ... Languages . ... Archi . ... The phonetic system of Archi is very rich, and the writing systems that are familiar to Archi speakers (Russian cyrillic and Avar cyrillic) are not sufficient for recording all sounds of the language. ... Kibrik et al. 1977] ? the notation used in this dictionary is given in the comparative table below under the label "1977"; [Kibrik, Kodzasov 1990]), but they were too difficult for the Archi speakers to learn and therefore remained inaccessible to them. ...

Еще в разделе: (Показать все результаты (>352) - www.philol.msu.ru/ )

• LangueDOC :: Courses
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/research_interests...

... The meeting took place in Florence, Italy, 7-11 June 2004. It was a joint meeting of the Commission of Soil Genesis and the Commission of Paleopedology of IUSS, the International Union of Quaternary Research and the Working Group of the World Reference Base for Soil Resources. ... Classification of paleosols and soils of reclaimed anthropic areas in World Reference Base and Soil Taxonomy and comparison between the different systems . ... Thanks to the Organizing Committee for the great meeting! ...

Еще в разделе: (Показать все результаты (>186) - www.fadr.msu.ru/ )