. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>23) - hit-conf.imec.msu.ru/ )

... Master Education . ... Master programs . ... Master program "Mathematical Models of Complex Systems: Theory, Algorithms, Applications" . ... The Mathematical Models of Complex Systems: Theory, Algorithms and Applications Master?s programme is aimed at studying the foundations of computational methods and software for new types of current problems in modelling, decision-making, and control of complex systems. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>133) - hcs.cmc.msu.ru/ )

• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и
• Master program "Enterprise Information Systems" | Магистерское и послевузовское
• Master program "Network Software" | Магистерское и послевузовское образование

International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...

Еще в разделе: (Показать все результаты (>706) - ilc.phys.msu.ru/ )

• Laser Graduate School
• "Computers and measurements" practical course laboratory
• Conference

... This program was created for correlating chosen regions in the series of fts images. ... Chosen regions' . ... In this section the program counts the integral for each region of the grid for each image. ... As a matter of fact, the integral is total brightness of the region and it is counted by 'int_tabulated' IDL function. ... In addition, the program will show the count of the regions which correlate with the corresponding region (the brighter region means the bigger count) and its contour. ...

Еще в разделе: (Показать все результаты (>218) - lnfm1.sai.msu.ru/ )

• GMATCH project
• Труды Ширмина Г.И.
• Problems

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Гафаров Е.Р. , Долгий А.Б. , Лазарев А.А. , Werner F. в журнале J Math Model Algor , том 13, ? ... Гафаров Е.Р. , Лазарев А.А. , Werner F. в журнале Mathematical Social Science , издательство Elsevier BV (Netherlands) , том 65, ? ... Гафаров Е.Р. , Лазарев А.А. , Werner F. в журнале Автоматика и телемеханика , ? ...

Еще в разделе: (Показать все результаты (>1227) - istina.msu.ru/ )

• Journal of Inverse and Ill-Posed Problems - журнал | ИСТИНА - Интеллектуальная
• Inverse Problems - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Gafarov E.R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Lomonosov Moscow State University . ... Academic Programs . Academic Board . International Cooperation . ... Academic Departments Programs . ... Bulletin of Moscow University . ... Contact Us . Phone Email Directory . ... Phone: (495) 734 03 22 . Fax: (495) 932 88 67 . ... Phone: (495) 932 99 15 . ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ... 2000 - 2016 Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>1311) - ffl.msu.ru/ )

• About Us
• Site map
• Academic Life

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>67) - geophys.geol.msu.ru/ )

• Anis. Page2
• Software for resistivity and induced polarization
• Support

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

The Center for Theoretical Problems in the Historical Sciences . ... The need to organize the new structure within the framework of Moscow State University was necessitated by the rapid advancement of the historical sciences in Russia, and furthermore, by the position which Moscow State University’s history faculty occupies, as the center of university history faculties in the Russian Federation. ...

Еще в разделе: (Показать все результаты (>37606) - hist.msu.ru/ )

• Russia and Western Countries: Economic Relations Before World War I and the
• Department of the History of Russian Social Movements and Political Parties
• The Food Supply Problem and the Ways Overcoming it in Eastern Siberia in the

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>119) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of
• Extra courses of the department | Department: General Problems of Control.

Search: . Word Search . ... All alternatives . Papers: . EDAS (submitted) . Other Papers . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>5) - edas2.bioinf.fbb.msu.ru/ )

• EDAS2 - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• BDRG | Университетский спутник "Ломоносов"
• DEPRON | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )