Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>239) - lnfm1.sai.msu.ru/ )

• IDL programs
• IrfanView HTML-Thumbnails
• Homepage of Koposov Sergey

NAME httpd - Apache hypertext transfer protocol server SYNOPSIS httpd [ - X ] [ - R libexecdir ] [ - d serverroot ] [ - f config ] [ - C directive ] [ - c directive ] [ - D parameter ] httpd [ - h ] [ - l ] [ - L ] [ - v ] [ - V ] [ - S ] [ - t ] [ - T ] DESCRIPTION httpd is the Apache HyperText Transfer Protocol (HTTP) server program. ... This manual page only lists the command line arguments. ... Paths in this manual may not reflect those compiled into httpd. ... The default is /usr/local/apache . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>92) - neptun.sai.msu.ru/ )

• Server-Wide Configuration
• Manual Page: htdigest - Apache HTTP Server
• Apache module mod_so

... Given package is a set of special commands and their handler - JOB program. The command aimed for description of often performed operations with files of PC-GAMESS program (dat, out, pun). ... Commands allow running calculation, performing other programs, data change between files and modification of files. ... Command inserts specified group in file.inp. ... del_g h2o.dat |Command deletes all repetition of| |$basis |specified group in file.inp. ... Command changes contents of group on specified | ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>63) - classic.chem.msu.su/ )

• Marek Checinski
• How to run Firefly under Linux?

... As a perfect bag of Hermes, it isn?t strange to determine it sold at $6,750. ... Didn`t suggest we don?t adore determine producer creative designers, . ... We will try our excellent to dig his worth come up with him merged properly making use of the brand, . ... I stated to plenty of folks that Christophe may be among the many most ideal one, . ... Leather: Handbags created by Hermes uses only animal skin. ... http://www.slcamera.it/every-man-adores-his-car/ . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>82) - elana.sinp.msu.ru/ )

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>34) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• download:cinterfaces101 [CompHEP]
• download:cinterfaces301 [CompHEP]

... ÎÒ×ÅÒÛ ÑÒÓÄÅÍÒΠΠÏÐÀÊÒÈÊÅ Â ÑÀÎ . Ëåòî 2001 ãîäà . ... Ãðèøàòîâîé Þëèè . ... Äëÿ îïðåäåëåíèÿ ëó÷åâûõ ñêîðîñòåé, FWHM (ïîëíîé øèðèíû íà ïîëîâèíå ìàêñèìóìà) è èíòåíñèâíîñòè ëèíèÿ He I 6678.15À îïèñûâàëàñü ãàóññèàíîé ( ðèñ.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>13) - heritage.sai.msu.ru/ )

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofš the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>44) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Óíèâåðñèòåòñêèé ñïóòíèê "Ëîìîíîñîâ"
• TUS | Óíèâåðñèòåòñêèé ñïóòíèê "Ëîìîíîñîâ"
• Lost Password | Óíèâåðñèòåòñêèé ñïóòíèê "Ëîìîíîñîâ"

... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... The purpose of this article is to analyze the creation of the Bryansk search station in 1909 in the context of political police reform in the Russian Empire. The author considers special conditions of political police activity in Bryansk district, explores the reasons for creating a search station, evaluates the role of Central Regional Secret Political Police Department. ... Public Administrarion". ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>187) - ee-journal.spa.msu.ru/ )

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>424) - chronos.msu.ru/ )

• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• Status of the Institute
• Laboratory-chair of Discrete mechanics on a microscopic scale

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>52) - cosmos.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>10) - mouse.genebee.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>28) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |
• Application for participation | MSU Higher school of management and innovation

Øêîëà òàíöåâ Ãðàöèÿ-ÌÃÓ . ... Ãðàöèÿ-ÌÃÓ::Ôîðóì Îáùåíèå Îáùåíèå . ... Ïëîõîé äåíü . ... Aug 30 2007, 09:39 . Ñîîáùåíèå #1 . born to create drama . I'll be the last man standing on the ground . ... Sep 1 2007, 13:15 . ... Ïîäïèñêà íà òåìó Ñîîáùèòü äðóãó Âåðñèÿ äëÿ ïå÷àòè Ïîäïèñêà íà ýòîò ôîðóì . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>932) - grace.msu.ru/ )

• Âåñòíèê òèðàíèè - Ãðàöèÿ-ÌÃÓ::Ôîðóì
• Âñÿ ïðàâäà ïðî áåëêó - Ãðàöèÿ-ÌÃÓ::Ôîðóì
• Íîðìû íå äëÿ íàñ - Ãðàöèÿ-ÌÃÓ::Ôîðóì

... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>20) - dynamo.geol.msu.ru/ )

... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>16) - imk.msu.ru/ )

• Èíñòèòóò ìèðîâîé êóëüòóðû ÌÃÓ

... Modeling of Temperature Field in Tissue Created by Therapeutic Phased Arrays with Regular and Random Distribution of Elements . ... Numerical algorithms for modeling of arbitrary three-dimensional acoustic and temperature fields in biological tissue are developed. Spatial distributions of acoustic intensity and temperature patterns in tissues created by two-dimensional therapeutic phased arrays with regular or random distribution of circular elements on a spherical shell are investigated. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>428) - acs366.phys.msu.su/ )

• AUTHOR : Filonenko E
• AUTHOR : Gavrilov L

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

38. Bulletin of Moscow Society of Naturalists. Biological series.

39. Ýëåêòðîííàÿ îáðàçîâàòåëüíàÿ ñðåäà èñòîðè÷åñêîãî ôàêóëüòåòà ÌÃÓ èìåíè

40. http://cryst.geol.msu.ru/literature/WOS.pdf