Structural Study of Oxidized Lignin Samples using Size-Exclusion Chromatography, NMR Spectroscopy and Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Andrey I. Konstantinov1, Ivan V. Dubinenkov1, Irina ... Philippe Schmitt-Kopplin2, Elena I. Fedoros3, Ivan V. Anikin4 Department of Chemistry, Lomonosov Moscow State University, Moscow, Russia , konstant@org.chem.msu.ru 2 The Institute of Ecological Chemistry, Helmholtz Zentrum MЭnchen, Neuherberg, ...

Еще в разделе: (Показать все результаты (>104) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-sorkina-synthesis.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-kononikhin-characterization.pdf

ORIGIN Place where sample was collected (for tissue samples data ) PLACE Same (for morphometry data ) TPS Leaf image present SAMPLE Tissue sample ID (for morphometry data ) SPECIES Species name (if in herbarium, from label) PLANT.ID Reference to image or other voucher data LEAF .DIST Distance from the base of the smaller branch to the base of chosen leaf , mm ...

Еще в разделе: (Показать все результаты (>106) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_240/data/nanodrop_c.txt
• The employment of quantitative methods for the lake ecosystem research
• International Journal on Algae Vol.1., No.2. 1999

Chemical differentiation of products of crushing by the grain-size fractions: example of Kovdor magnetite ore . ... The sample was crushed in an iron mortar and divided into the grain-size fractions: +1 mm, -0.5+1 mm and -0.5 mm. ... The chemical compositions of grain-size fractions after the crushing of one sample of a magnetite ore. ... The coarsest fraction is enriched in iron, alumina, titanium and zinc (mainly concentrated in magnetite) and also in phosphorous (mainly concentrated in apatite). ...

Еще в разделе: (Показать все результаты (>254) - geo.web.ru/ )

• My Gallery Title Bar Text

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>50) - hbar.phys.msu.ru/ )

... Laboratory sample measurements are long used worldwide for this purpose. ... The samples were taken from non-polluted site and the pollutants were added in them in the laboratory. ... Further on the degree of saturation was kept up by adding water to the samples daily. ... The chargeability difference between non-polluted sample and other samples increases rapidly during the first week and then the rate of change grows less becoming almost negligible in the end of the measurement time span. ...

Еще в разделе: (Показать все результаты (>25) - geophys.geol.msu.ru/ )

... Package . Class . ... DimensionSet is an inquiry interface for a collection of Dimensions. Netcdf . ... This abstract class provides a skeletal implementation of the Netcdf interface. ... A Dimension object is used to contain an array length which is named for use in multiple netcdf variables. ... A concrete implementation of the Netcdf interface, this class provides connection to NetCDF version 1 files. ... Interface Netcdf - Extends set of Variable, has a DimensionSet and an AttributeSet. ...

Еще в разделе: (Показать все результаты (>7) - angel.cs.msu.su/ )

• : Overview
• : Class DecimateMap

. Первая страница Назад Продолжить Последняя страница Обзор Изображения . P ~ exp [( I ( A new)] .

Еще в разделе: (Показать все результаты (>176) - kodomo.cmm.msu.ru/ )

• TracTicketsCustomFields тАУ Tanchiki

... Лаборатория теоретической биофизики . ... FRAP kinetics can be measured from image series directly with numpy libraries. ... Here we provide script that helps you to remove sample motion and obtain FRAP kinetics from image series with console script. ... Here oribl is a small image and _im is full image. ... Нет комментариев " Python script for processing FRAP image set " . ... Python script for processing FRAP image set . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>6) - erg.biophys.msu.ru/ )

• FRAP ERG Research Group: Лаборатория теоретической биофизики

... Optical-Acoustic Spectroscopy of Structural Changes in Metals Under Shock Loading . ... The results of experimental investigations of metal structure changes by a optical.acoustic spectroscopy method are submitted. Iron and nickel samples subjected to vacuum annealing at different temperatures were investigated. ... In samples with the different grain size the plastic deformation in a loading zone leads to reorganization of structure completed at different scale levels. ...

Еще в разделе: (Показать все результаты (>59) - acs366.phys.msu.su/ )

• Abstract (Invited)

A new Monte Carlo method of the numerical integration "Superposing Method" T.Kaneko and K.Tobimatsu * KEK, Tsukuba Japan *Kogakuin University, Tokyo Japan 1. Basic idea Division method Random Sampling Superposing method Regions are deterministic ACAT2002 in Moscow, Superposing method TK & KT Regions are randomly taken 2 The method is more flexible than usual division method in choosing a shape for sub -region. ... ACAT2002 in Moscow, Superposing method TK & KT 6 3. ...

Еще в разделе: (Показать все результаты (>29) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/presentations/ososkov/ACATOsoskov.doc

DAYS on DIFFRACTION 2015 1 Femtosecond sp ectroscopy of the electron thermalization in gold in the vicinity of Tamm plasmon resonance Afinogenov B. I., Bessonov V. O., Fedyanin A. A. Faculty of Physics, Lomonosov Moscow State University, Moscow, 119991, Russia e-mail: fedyanin@nanolab.phys.msu.ru Tamm plasmon-polaritons (TPPs) have attracted huge interest since their first experimental observation in 2008. ... Spectrum of the relative change in reflectivity R/R is shown with black dots. ...

Еще в разделе: (Показать все результаты (>61) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/iconolat.pdf
• http://nanolab.phys.msu.ru/sites/default/files/pe14_abstracts.pdf
• http://nanolab.phys.msu.ru/sites/default/files/prb82_193402_2010.pdf

download:cpythwarning ]] . CompHEP . ... If you would like to pass you CompHEP events through PYTHIA/HERWIG, download and install CompHEP-4.5 and pass your sample through traslator ar first. ... LHE is supported by PYTHIA by default and HERWIG (with a simple code in CompHEP-interfaces-3.00 or later). CompHEP-interface-3.0.0 provides a simple environment for working with events in LHE as external event flow in PYTHIA and HERWIG. ... Community contributions . ... CompHEP-3.3 Manual . ...

Еще в разделе: (Показать все результаты (>8) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... For high style along with a brand name to boot, pick within the Gucci Secret bag for $2,300.00. The lock detail on this bag is fully gone in an awesome straw color with light brown crocodile and light brown leather trim and brass parts. ... The zip top closure keeps all your items safely stowed, insurance coverage bottom feet keep this bag protected from general deterioration. ... http://www.webdesign.icreate.com.cy/gucci-handbags-and-several-other-bags-of-latest-designs/ . ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>8) - elana.sinp.msu.ru/ )

• michael kors outlet uk who owned and operated the Freedom Hosting service
• editor | С Днем Победы!

... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...

Еще в разделе: (Показать все результаты (>5) - magn.phys.msu.ru/ )

... Let $(X_n)$ be a strictly stationary random sequence with the marginal distribution functions $F(x)=P{X_1\leq x}$. ... Let us denote $ M_n=\max {X_1,.. ... The limiting distributions of the random vector $(\tilde{M_n}, M_n)$ and "asymptotic independency" of $\tilde{M_n}$ and $M_n$ are obtained under some condition of weak dependency of random variables from sequence $(X_n)$, which is more restrictive than Leadbetter's $D(u_n)$ condition, and some conditions on the sequence $(\varepsilon_n)$. ...

Еще в разделе: (Показать все результаты (>10) - new.math.msu.su/ )

• Courses

... Air pollution induced changes in pine needle chemistry were observed at sample sites in the surroundings of the Pechenganikel smelter. ... Close to the pollution source needles were enriched in Ni and Cu by needle age. Correlation and principal component analyses show that changes in the element composition of pine needles depended on air pollution and on natural factors as well. The contribution from air pollution increased with needle age. ...

Еще в разделе: (Показать все результаты (>5) - eco.soil.msu.ru/ )

... Faculty of Biology . EEG Records Databases [ <<< ] . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . EEG Database Description . There are two EEG data archives for two groups of subjects. ... Each TXT file contains a column with EEG samples from 16 EEG channels (electrode positions). ... First 7680 samples represent 1st channel, then 7680 - 2nd channel, ets. The sampling rate is 128 Hz, thus 7680 samples refer to 1 minute of EEG record. ...

Еще в разделе: (Показать все результаты (>46) - brain.bio.msu.ru/ )

• Change-points at different levels of the hierarchy of EEG segmental...
• Change-point detection algorithm performance with real EEG
• Non-stationarities in EEG. Methods of segmentations of the EEG signal

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Новая методика мониторинга биодеградации летучих органических соединений. ... Предложена новая методика мониторинга биодеградации летучих органических соединений с использованием скоростной газовой хроматографии. Представлена схема отбора и подготовки проб и отмечено, что эксперименты, целью которых было определение метрологических характеристик новой методики, проводились с использованием биореактора, обеспечивающего деградацию стирола и толуола, содержащихся в воздухе. ...

Еще в разделе: (Показать все результаты (>2) - ecoinformatica.srcc.msu.ru/ )

... Authors: Charles C. H. Jui, for the Telescope Array Collaboration . arxiv:1110.5338 К построению общей картины результатов экспериментов CRESST, CoGeNT и DAMA (Toward A Consistent Picture For CRESST, CoGeNT and DAMA) . ... arxiv:1110.5049 Сетка звездных моделей с учетом вращения - I. Модели от 0.8 до 120 солнечнаых масс при солнечной металличности (Z=0.014) (Grids of stellar models with rotation - I. Models from 0.8 to 120 Msun at solar metallicity (Z = 0.014)) . ... Authors: Mario Hamuy ...

Еще в разделе: (Показать все результаты (>52) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1312.html
• http://xray.sai.msu.ru/~polar/sci_rev/1501.html