The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>211) - hist.msu.ru/ )

• Moscow State University. the Faculty of History. Korean web-page

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>117) - elana.sinp.msu.ru/ )

• Наши ветераны | С Днем Победы!

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>20) - cdfe.sinp.msu.ru/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>635) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,
• The RU-NGI Third quarter 2011 Archive by author

This example program looks like a complete modern application. ... ApplicationWindow :: ApplicationWindow () : QMainWindow ( 0, example application main window ) { printer = new QPrinter ; printer- setMinMax( 1, 10 ); QPixmap openIcon, saveIcon, printIcon; fileTools = new QToolBar ( this, file operations ); openIcon = QPixmap( fileopen ); QToolButton * fileOpen = new QToolButton ( openIcon, Open File , 0, this, SLOT ( load ()), fileTools, open ...

Еще в разделе: (Показать все результаты (>520) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QNPStream member list
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>10) - angel.cs.msu.su/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>4786) - kodomo.fbb.msu.ru/ )

• allpy: log

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>32) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 5/2011
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Правила

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>4) - www.issp.ac.ru/ )

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>80) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>213) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• The Network File System

Process of Forming a Company Where Are You Now? ... How much more money do you need invested in your company before you will see profit? a. $50 - $100,000 b. $100,000 - $500,000 c. $500,000 - $1 million d. $1 million - $5 million e. $5 million - $10 million f. More than $10 million 7. ... How much management experience do you have? a. None b. I've dabbled a little bit c. I've managed a lab/research group d. I've helped someone manage a venture in the past e. I've managed my own venture in the past 9. ...

Еще в разделе: (Показать все результаты (>36) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>280) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>70) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• About authors ot this complex

... ATTENDANCE SURVEY: FIRST KEPLER SCIENCE CONFERENCE . If you are interested in attending the First Kepler Science Conference, please complete a short survey at: . ... The First Kepler Science Conference will be held 5-9 December 2011, hosted by the NASA Ames Research Center, Moffett Field, California. ... July 3-8, 2011 Bioastronomy Conference, Montpellier, France . ... April 26-29, 2010 Astrobiology Science Conference (AbSciCon) 2010 in League City, Texas . ... НАУЧНАЯ КОНФЕРЕНЦИЯ SETI - 2005 . ...

Еще в разделе: (Показать все результаты (>132) - lnfm1.sai.msu.ru/ )

• Trip over old Shanghai
• HSFA 2 technical description Technical Details
• Natural Satellites Data Center. Objectiv.

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>204) - uneex.lorien.cs.msu.su/ )

• Module Index - Apache HTTP Server
• Conditionals
• Real-World Package Building

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>65) - uneex.mithril.cs.msu.su/ )

... Since 2003 he studied in the subdepartment of Mathematical Theory of Intelligent Systems under the supervision of Prof. V.B.Kudryavtsev. ... In 2006 Dmitriy graduated with distinction from department of mathematics and continued his postgraduate studies in the subdepartment of Mathematical Theory of Intelligent Systems, where he did his research in Automata Theory. ... Dmitriy completely described the lattice of all clones of self-dual functions in three-valued logic. ...

Еще в разделе: (Показать все результаты (>56) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Safiullin Alexander Naifovich

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>114) - www.fadr.msu.ru/ )

• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD
• Online Registration