... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... testing Test Complete . ... тул Test Complete для автотестирования, кто нить работал с ним? . ... Re: testing Test Complete [ re: nafania ] . ...

Еще в разделе: (Показать все результаты (>11272) - www.fds-net.ru/ )

• Новинки (аниме, осты, фильмы, дорамы...) - Public forum of MSU united student

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>187) - www.pereplet.ru/ )

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>138) - phys.msu.ru/ )

... Progress . ... RMA calls must have local semantics, except when required for synchronization with other RMA calls. ... On the origin process, an RMA communication may become enabled as soon as the corresponding put, get or accumulate call has executed, or as late as when the ensuing synchronization call is issued. ... This code will deadlock: the wait of process 1 blocks until process 0 calls complete, and the receive of process 0 blocks until process 1 calls send. ... Центры . ...

Еще в разделе: (Показать все результаты (>438) - www.parallel.ru/ )

• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Semantics of Nonblocking Communications | PARALLEL.RU -

... Korotkevich A.A. Complete Commutative Sets of Polynomials for Solvable Lie Algebras of Dimension Six and Nilpotent Lie Algebras of Dimension Seven . Zvyagin A.V., Kolpakov V.P. Flow of a Viscous Fluid down a Slope . Stepanenko I.I. A Modification of the Least-Squares Method in the Identification Problem for Elastic Laminated Composites . Bugrov D.I. Bulgakov Problem of the Accumulation of Perturbations . ...

Еще в разделе: (Показать все результаты (>153) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 2/2014

Table 1. One-factor characteristics of dependence of plankton and periphyton ecological state on polluting compounds . Factors . ... 231 . ... 116 . ... 115 . ... 0.000 . ... 231.000 . 0.150 . ... 100 . ... N = number of observations; N1 = number of normal observations; N2 = number of abnormal observations; Min is the minimum factor value for the period of observation; Max is the maximum factor value for the period of observation; ETL is the ecologially tolerable level of the factor. ...

Еще в разделе: (Показать все результаты (>864) - chronos.msu.ru/ )

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>517) - hist.msu.ru/ )

. This is the complete list of member functions and enum types for QNPStream , including all inherited members. QNPStream . complete . end . instance . lastModified . okay . requestRead . seekable . setComplete . setOkay . type . url . write . ~QNPStream . Copyright © 1998 Troll Tech . Trademarks . Qt version 1.40

Еще в разделе: (Показать все результаты (>496) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream Class
• Qt Toolkit - QXtWidget member list

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>18) - angel.cs.msu.su/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>17) - cdfe.sinp.msu.ru/ )

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>509) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: CERN CA Website IP change
• Михаил Дубинин - Mikhail Dubinin (Skobeltsyn Institute of Nuclear Physics,
• The RU-NGI Third quarter 2011 Archive by author

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>119) - www.mgubs.ru/ )

... РЕФЕРАТЫ СТАТЕЙ ПО РУКОКРЫЛЫМ / ABSTRACTS OF BAT ARTICLES . Глобальная оценка полноты ископаемых остатков рукокрылых / Global completeness of the bat fossil record: - Eiting, T.P., Gunnell, G.F., Journal of Mammalian Evolution, 16(3): 151-173, 2009. ... Measures of completeness of the fossil record have important consequences for our understanding of evolutionary rates and patterns among bats. ... At the genus level, the bat fossil record is estimated to be 12% complete. ...

Еще в разделе: (Показать все результаты (>772) - zmmu.msu.ru/ )

• Order Chiroptera
• Russian Journal of Theriology
• Bat specialists

You are here: Foswiki > System Web > JQueryPlugin > JQueryMaskedInput (revision 2) E dit A ttach . Homepage: http://digitalbush.com/projects/masked-input-plugin . ... It allows a user to more easily enter fixed width input where you would like them to enter the data in a certain format (dates,phone numbers, etc). ... a - Represents an alpha character (A-Z,a-z) . ... date").mask("99/99/9999"); $("#phone").mask("(999) 999-9999"); $("#tin").mask("99-9999999"); $("#ssn").mask("999-99-9999"); . ...

Еще в разделе: (Показать все результаты (>3694) - wiki.cmc.msu.ru/ )

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>4955) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>11) - statsoft.msu.ru/ )

• InCo literature in English
• InCo Products Page

... Copyright © 1996,1997,1998,1999 David A Rusling . ... This book (``The Linux Kernel'') may be reproduced and distributed in whole or in part, without fee, subject to the following conditions: . The copyright notice above and this permission notice must be preserved complete on all complete or partial copies. ... If you distribute this work in part, instructions for obtaining the complete version of this manual must be included, and a means for obtaining a complete version provided. ...

Еще в разделе: (Показать все результаты (>183) - itpm.msu.su/ )

• Kernel Options in 1.0 and Higher
• Module Index - Apache HTTP Server
• Delivering News

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>305) - uneex.mithril.cs.msu.su/ )

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>569) - uneex.lorien.cs.msu.su/ )

• PRODUCT
• G_PRODUCT
• Conditionals