... Different domain organization of two main conformational states of Na+/K+-ATPase]. ... The melting curves for the apoforms of Na+/K+-ATPases have different shapes: the curve for the enzyme from the rabbit shows one transition at 56.1 degrees C, whereas the denaturation of Na+/K+-ATPase from the duck is characterized by two transitions, at 49.8 and 56.9 degrees C. Sodium and potassium ions abolish the difference in the domain organization of Na+/K+-ATPases. ...

Еще в разделе: (Показать все результаты (>83) - biochem.bio.msu.ru/ )

• Generation of superoxide by the mitochondrial Complex I.

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>24) - dbserv.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>57) - erg.biophys.msu.ru/ )

• pymol ERG Research Group: Лаборатория теоретической биофизики
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• OPLS ERG Research Group: Лаборатория теоретической биофизики

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>268) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/107.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/45.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/134.pdf

Genesis of carbonatites : inferences from a world map and database . ... The repetition of carbonatite emplacement in restricted areas of continental lithosphere/plate, which have generally drifted considerable distances between episodes of carbonatitic volcanism, must preclude any genesis involving mantle plumes, and underlines the crucial role that the lithosphere undoubtedly plays in carbonatite generation. ... Carbonatite occurrences of the world: map and database. ...

Еще в разделе: (Показать все результаты (>375) - geo.web.ru/ )

• Mineralogy Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -
• Geochemical Rock Database - Все о Геологии (geo.web.ru)

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... We found that automatic models are significantly worse at predicting attention than even single-observer eye tracking. We propose a semiautomatic approach that requires eye tracking of only one observer and is based on time consistency of the observer?s attention. ... Gitman Y, Erofeev M, Vatolin D, Bolshakov A, Fedorov A. Semiautomatic Visual-Attention Modeling and Its Application to Video Compression . ...

Еще в разделе: (Показать все результаты (>164) - graphics.cs.msu.ru/ )

• Semiautomatic Visual-Attention Modeling | Лаборатория компьютерной графики и
• Image Database Retrieval by Fast Hermite Projection Method | Graphics and Media
• Image Database Retrieval by Fast Hermite Projection Method | Лаборатория

... Changed: . Add structure to content with forms attached to twiki topics. ... Field values can also be obtained as the result of a FormattedSearch . ... when used in the value field of the form definition, this will find all topic names in the Main web which end in "Office" and use them as the legal field values. When used in the value field of the form definition, this will find all topic names in the Main web which end in "Office" and use them as the legal field values. ... Topic* | ...

Еще в разделе: (Показать все результаты (>36906) - dualopt1.cmm.msu.ru/ )

• AppendixEncodeURLsWithUTF8 - TWiki - TWiki
• AppendixEncodeURLsWithUTF8 - TWiki - TWiki - (printable)
• %TOPICTITLE% (17 vs. 18) - TWiki

Experience with OO Database for CMS Events Distributed Between Two Sites. ... Participation of Russian institute (5% of all CMS simulations): Spring 2000 year - SINP MSU + ITEP - 50000 events , 25 GB transferred to CERN Autumn 2000 year - SINP MSU + ITEP + JINR - 110000 events , 180 GB transferred to CERN Autumn 2001 year - ( SINP +RRC)+ ITEP + JINR +FIAN - 270000 events , OO Database distributed between SINP and ITEP ~200 GB ...

Еще в разделе: (Показать все результаты (>56) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/pose/talk.doc
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>48) - old.philol.msu.ru/ )

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kireeva N. , Baskin I.I. , Gaspar H.A. , Horvath D. , Marcou G. , Varnek A. в журнале Molecular informatics , издательство Wiley-VCH Verlag (Weinheim, Germany, Germany) , том 31, ? ...

Еще в разделе: (Показать все результаты (>1677) - istina.msu.ru/ )

• Marcou Gilles - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Advances in database technology : proceedings. International Conference on
• Varnek Alexandre - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>70) - electr003.chem.msu.ru/ )

Next: Architecture Up: Implementation Overview Previous: Migrating Objects . The Basic Object Adapter provides a bare minimum of functionality to server applications. As a consequence, many ORBs added custom extensions to the BOA to support more complex demands upon an object adapter, making server implementations incompatible among different ORB vendors. In CORBA 2.2, the new Portable Object Adapter was introduced. ... Allow a single servant to support many object identities. ...

Еще в разделе: (Показать все результаты (>625) - rtm-cs.sinp.msu.ru/ )

• sendmail address rewriting mini-HOWTO
• IDL Compiler
• Unions

Just a little program for analysis of different alignments . ... Several words about COGs . ... COGs (Clusters of Orthologous Genomes) is a big database, which consists of thousands of alignments. Every alignment contains from 2 to almost infinite quantity sequences. ... It's very diffucult to look through big alignments, such as, for example, COG0495 (even though it is almost empty) - they contain too much lines. ... New sequences are discovered, new alignments are made and added into COGs. ...

Еще в разделе: (Показать все результаты (>81) - monkey.belozersky.msu.ru/ )

• Molecular biology databases
• ETS species distribution
• HTH3_species_distribution

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>73) - www.kosmofizika.ru/ )

• Index of /spravka/Magnetometers Database.files

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>75) - hist.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>76) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research
• Intelligent Systems :: Research :: :: Research

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• Coronal holes database - Space monitoring data center
• Coronas-F - Space monitoring data center
• Prognos-9 - Space monitoring data center