. [ Войти ] . Главная -> Фильмы -> Parrot Sketch Not Included: .. Пользователи . Демо . Деньги . Фильмы . Форум . Parrot Sketch Not Included: Twenty Years of Monty Python . Неизвестные Скетчи Монти Пайтон . Великобритания 1989 . отметить . Комедия . Ian MacNaughton . Steve Martin . Graham Chapman . John Cleese . Terry Gilliam . Eric Idle . Terry Jones . Michael Palin . Carol Cleveland . Connie Booth . Basil Tang . Marjorie Wilde . The Fred Tomlinson Singers .

Еще в разделе: (Показать все результаты (>4) - kinfo.ru/ )

• *batteries not included - Фильмы - Kinfo.ru

... 2015-12-17 12:35 . 1.2K . ...

Еще в разделе: (Показать все результаты (>125) - herba.msu.ru/ )

• Index of /shipunov/school/biol_448/nd_keys/nd_plant_families/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_labiatae/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_compositae/includes

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MinGW + QT [Windows] траблы с include-директориями . ... как настроить MinGW, чтобы он меня видел? ... Re: MinGW + QT [Window] траблы с include-директориями [ re: StepLg ] . ...

Еще в разделе: (Показать все результаты (>551) - www.snto-msu.net/ )

• iostream - Public forum of MSU united student networks
• Re: На злобу дня - Public forum of MSU united student networks
• Re: юмор в этом разделе - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MinGW + QT [Windows] траблы с include-директориями . ... как настроить MinGW, чтобы он меня видел? ... Re: MinGW + QT [Window] траблы с include-директориями [ re: StepLg ] . ...

Еще в разделе: (Показать все результаты (>965) - www.fds-net.ru/ )

• Re: На злобу дня - Public forum of MSU united student networks
• Как передать параметр в g++ к исходнику - Public forum of MSU united student
• [c++] возможно ли произвольное число циклов без рекурсии? - Public forum of MSU

... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Programs include free Academics Athletics . ... Since starting, TOMS is actually on track to assist give view by the end of 2012 to over One hundred,000 people in require within 13 nations through the acquisition of TOMS Eyeglasses. ... Toms Shoes outlet . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>3149) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: this leather of including
• Экологический Форум - Фундаментальная Экология: consumers. Yves Mall including:
• Экологический Форум - Фундаментальная Экология: includes a more compact head

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>12) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... Academic Departments . ... Partners . ... All partners . ...

Еще в разделе: (Показать все результаты (>59) - www.journ.msu.ru/ )

• Faculty of Journalism, Lomonosov Moscow State University was included in the
• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• Russian Media and Journalism International Programme :: Department of

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>60) - www.mmonline.ru/ )

• MMOnline | Развлечения | Эволюция Программиста
• MMOnline | Новости | Эволюция Программиста

... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>407) - theory.sinp.msu.ru/ )

• [Comphep-common] MSSM Feynman gauge
• QFTHEP'99
• CalcHEP Licence

... Minimal size of Clud clusters (residues) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Hydrophobic cluster of a single protein structure is a separated pool of nonpolar atoms. Usually there is the biggest cluster in the protein called hydrophobic core. ... ConClus program is able to detect of conservative hydrophobic clusters for a family of related protein domains or just for a set of aligned proteins. ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ­ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ­ Blocking: ­ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI «-» () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~ifed/teraflops/Popova_OpenMP.pdf

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>166) - xray.sai.msu.ru/ )

• PROBLEMS OF THEORETICAL COSMOLOGY - UISS2000
• My Favourite music
• Seminars

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...

Еще в разделе: (Показать все результаты (>14) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and

topology for 1 alm molecule, 128 popc lipids, water and 1 counter ion ; alm.itp can be made in a straightforward manner with pdb2gmx, starting ; with a pdb file of alamethicin . ; make sure lipid.itp , popc.itp and alm.itp are in a location where ; grompp can find them (GMXLIB, current directory , or directory given in ; the .mdp file with the include option. # include ffgmx.itp # include ...

Еще в разделе: (Показать все результаты (>2148) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~borisevich/term6/Pr13/dimer.top
• http://kodomo.cmm.msu.ru/~zhuravlka/term6/pr13/dimet.top
• http://kodomo.cmm.msu.ru/~anuta_al/projects/b.top

... Sequence conservation . 3D conservation . All contacts alignment . ... Hydrophobic contacts . Contacts with DNA . ... There was found only one conserved hydrophobic cluster on the protein-DNA interface, which could be important in term of DNA recognition and binding. ... At the same time, Met305 makes no other contacts with DNA, so its participating in this hydrophobic cluster may be considered as the main reason of its high conservation. ... S main page < Previous page ...

Еще в разделе: (Показать все результаты (>257) - monkey.belozersky.msu.ru/ )

• Homeodomain numeration assumed
• 1FJL biounits
• About this project

... Полная версия этой страницы: Чтение в массив строк . Студенческий форум Физфака МГУ > Физфак и учеба > Экзамены, зачеты, лекции, семинары, физпраки . ... надо считать их в массив строк.На Си. ... int main (int argc, char *argv[]) { . ... char data[255]; . ... char string_c[255][2048]; . ... массив размером 2048 на 255: 2048 макс строк в нем и 255 символов в строке. это не прога а полуфабрикат, добавь проверку на невылазанье из границы массива . ... char * tmpstr;//Заводим временную строку . ...

Еще в разделе: (Показать все результаты (>169) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Старые добрые mex-фукции
• Студенческий форум Физфака МГУ > Software Developer
• Студенческий форум Физфака МГУ > ПОМОГИТЕ БЛОНДИНКЕ В ПРОГЕРСТВЕ

Sorex , including chromosome races of Sorex araneus . RAPDs in representatives of the genus Sorex , including chromosome races of Sorex araneus . ... We also examined RAPDs in 26 individuals of six chromosome races of the common shrew (Moscow, Ilomantsi, St. Petersburg, Neroosa, Penza, and Sok) from the European part of Russia. ... Evolution of Shrews. ... Chromosome races of the common shrew Sorex araneus in Poland: a model of karyotype evolution // Acta Theriologica. ...

Еще в разделе: (Показать все результаты (>1008) - zmmu.msu.ru/ )

• Plecotus - Long-eared bats
• Cladistic analysis of the dormouse genus Graphiurus Smuts, 1832 (Rodentia:
• Hypsugo - Serotine-like pipistrelles

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>137) - www.genebee.msu.ru/ )

• Genebee Advanced BLAST 2.0
• GEA :: Gene Expression Analysis
• Databases

... Visual C++ (short) 2 ( -215 В 215-1 0 В 216-1 6553510 (unsigned short), (long) 4 ( -231 В 231-1). , : 0.13·108. float , - . ... 2 (1 , ) , VC int short long char float double 138 -367 1,345 -0,15 4 2 4 1 4 8 138 -367 1.345 -0.15 -.15 138L , 8 16 118 = 9 10 10 2 , short<=int<=long + unsigned: unsigned int, unsigned short, unsigned long, unsigned char sizeof() . ... include <stdlib.h> #include <time.h> int i,j; srand( (unsigned)time( NULL )); i = rand(); j = rand(); . ...

Еще в разделе: (Показать все результаты (>33) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/science_education/lections/CS/cp/Cpp_C1.pdf
• Упражнение 1. 1