. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>6) - ecoinformatica.srcc.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...

Еще в разделе: (Показать все результаты (>32) - seac47-2.phys.msu.ru/ )

• Database search page
• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

... Different domain organization of two main conformational states of Na+/K+-ATPase]. ... The melting curves for the apoforms of Na+/K+-ATPases have different shapes: the curve for the enzyme from the rabbit shows one transition at 56.1 degrees C, whereas the denaturation of Na+/K+-ATPase from the duck is characterized by two transitions, at 49.8 and 56.9 degrees C. Sodium and potassium ions abolish the difference in the domain organization of Na+/K+-ATPases. ...

Еще в разделе: (Показать все результаты (>73) - biochem.bio.msu.ru/ )

• Generation of superoxide by the mitochondrial Complex I.

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>25) - dbserv.sinp.msu.ru/ )

download:rn-080423 ]] . CompHEP . ... THE VERSION 4.5.0rc2 IS A TEST RELEASE! ... 4.5.0rc1: some tiny bugs in generated event files in LHE . 4.4.113: Temporary stopper for Latex generation for 2Б†’N, N>4 . ... 4.4.98: working symb_batch.pl with new option for parallel calculations . ... 4.4.91: Three bugs in generation of session.dat with s_comphep . ... 4.4.90: Several bugs in generation of session.dat with s_comphep . ... 4.4.96: CompHEP-ROOT interface, for histogramming only . ... News . ...

Еще в разделе: (Показать все результаты (>89) - comphep.sinp.msu.ru/ )

• news [CompHEP]
• download:rn-070606 [CompHEP]
• download:rn-070607 [CompHEP]

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>57) - erg.biophys.msu.ru/ )

• pymol ERG Research Group: Лаборатория теоретической биофизики
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• OPLS ERG Research Group: Лаборатория теоретической биофизики

The database of triplet periodicity change points Y.M. Suvorova, E.V. Korotkov Centre of Bioengineering Russian Academy of Sciences, 117312, prospect 60 -tya Oktyabrya 7/1, Moscow, Russia, suvorovay@gmail.com It is well-known that triplet periodicit y (TP) is the dist inguishing feature of protein coding sequences of the majorit y of the living organisms [1]. ... The current version o f the database includes 179 238 records of protein coding sequences with triplet periodicit y change points. ...

Еще в разделе: (Показать все результаты (>261) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/107.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/45.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/134.pdf

Genesis of carbonatites : inferences from a world map and database . ... The repetition of carbonatite emplacement in restricted areas of continental lithosphere/plate, which have generally drifted considerable distances between episodes of carbonatitic volcanism, must preclude any genesis involving mantle plumes, and underlines the crucial role that the lithosphere undoubtedly plays in carbonatite generation. ... Carbonatite occurrences of the world: map and database. ...

Еще в разделе: (Показать все результаты (>331) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Lapin1.htm
• Mineralogy Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -

... Changed: . Add structure to content with forms attached to twiki topics. ... Field values can also be obtained as the result of a FormattedSearch . ... when used in the value field of the form definition, this will find all topic names in the Main web which end in "Office" and use them as the legal field values. When used in the value field of the form definition, this will find all topic names in the Main web which end in "Office" and use them as the legal field values. ... Topic* | ...

Еще в разделе: (Показать все результаты (>37781) - dualopt1.cmm.msu.ru/ )

• NatSkinFAQ - TWiki - TWiki - (printable)
• %TOPICTITLE% (1 vs. 2) - TWiki

Experience with OO Database for CMS Events Distributed Between Two Sites. ... Participation of Russian institute (5% of all CMS simulations): Spring 2000 year - SINP MSU + ITEP - 50000 events , 25 GB transferred to CERN Autumn 2000 year - SINP MSU + ITEP + JINR - 110000 events , 180 GB transferred to CERN Autumn 2001 year - ( SINP +RRC)+ ITEP + JINR +FIAN - 270000 events , OO Database distributed between SINP and ITEP ~200 GB ...

Еще в разделе: (Показать все результаты (>49) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/pose/talk.doc
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf
• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf

Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>48) - old.philol.msu.ru/ )

... Species distribution . ... According to Pfam database there have been found 487 ETS genes to date, most of which turned out to belong to different species of animal kingdom. ... The following table shows the number of ETS genes present in genomes of most intensively studied species. The number of ETS genes found in genomes of most intensively studied species . ... The following table shows the number of well studied ETS proteins and their distribution among species. ... ETS1, SPI1, SPIB . ...

Еще в разделе: (Показать все результаты (>67) - monkey.belozersky.msu.ru/ )

• HTH3_species_distribution
• About COGs
• Molecular biology databases

... This document is a brief description of how to set up sendmail's configuration file for the home user's dial-up access. ... 3.2 Address rewriting . ... Sending mail between various local users must be possible. ... We will put all of sendmail's configuration files in a separate directory under etc : etc mail . ... To avoid problems, etc sendmail.cf should be a symbolic link to etc mail sendmail.cf . ... genericstable - contains the actual rewriting rules. sendmail.cf - sendmail's configuration file ...

Еще в разделе: (Показать все результаты (>624) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QListBoxText Class
• Qt Toolkit - QBrush Class
• Qt Toolkit - QPen Class

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Kireeva N. , Baskin I.I. , Gaspar H.A. , Horvath D. , Marcou G. , Varnek A. в журнале Molecular informatics , издательство Wiley-VCH Verlag (Weinheim, Germany, Germany) , том 31, ? ...

Еще в разделе: (Показать все результаты (>1461) - istina.msu.ru/ )

• Marcou Gilles - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Advances in database technology : proceedings. International Conference on
• Varnek Alexandre - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>69) - electr003.chem.msu.ru/ )

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>76) - www.kosmofizika.ru/ )

• Index of /spravka/Magnetometers Database.files

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>90) - hist.msu.ru/ )