All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>61) - classic.chem.msu.su/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. November 11, 1997 . The Annotated Galactic Center . ... Constellations of nearby stars include Sagittarius , Libra , Scorpius , Scutum , and Ophiuchus . ... Open clusters include M6 , M7 , M18 , M21 , M23 , M24 , M25 . Globular clusters include M9 , M22 , M28 , M54 , M69 , M70 . ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>5) - www.arcetri.astro.it/ )

... Is only visible when cellspacing is larger than 1, or cellborder is 0 , or tablerules is none , otherwise the cell borders overlap the table border. unspecified . ... Table rules, set to "none" (no rules), "groups" (rules will appear between row groups and column groups only), "rows" (rules will appear between rows only), "cols" (rules will appear between columns only), "all" (rules will appear between all rows and columns). ... unspecified . ... This topic: System > Plugins > TablePlugin > VarTABLE...

Еще в разделе: (Показать все результаты (>4527) - wiki.cmc.msu.ru/ )

• JQueryCycle < System < Foswiki
• PatternSkinTheme < System < Foswiki

... Starting Multiple Executables and Establishing Communication . Up: Process Manager Interface Next: Reserved Keys Previous: Starting Processes and Establishing Communication . ... The following routine spawns multiple binaries or the same binary with multiple sets of arguments, establishing communication with them and placing them in the same MPI_COMM_WORLD. ... MPI_COMM_SPAWN_MULTIPLE is identical to MPI_COMM_SPAWN except that there are multiple executable specifications. ... Центры . ...

Еще в разделе: (Показать все результаты (>205) - www.parallel.ru/ )

• The mpicc and mpif77 commands | PARALLEL.RU - Информационно-аналитический центр
• The
  <tt> mpicc
  </tt> and
  <tt> mpif77
  </tt> Commands | PARALLEL.RU -
• User commands | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Template class that provides arrays of simple types . ... Internal class, used with QBitArray . ... Lines up child widgets horizontally or vertically . ... The abstract base class of button widgets, providing functionality common to buttons . ... Template class that provides a cache based on char* keys . ... Event parameters for child widget events . ... Base class of all event classes. ... Event parameters for widget focus events . ... The base class of widgets that have an (optional) frame . ...

Еще в разделе: (Показать все результаты (>441) - rtm-cs.sinp.msu.ru/ )

• Installing MICO
• Qt Toolkit - QHeader Class
• Apache module mod_mime_magic

US Robotics 16800 Courier HST DS FAX Switches Description Auto Answer on ring ФФФФФФФФП кФФФФФФФФФФФ Normal Carrier Detect Echo Offline Commands ФФФФП Г Г кФФФФФФ Display All Result Codes Suppress result codes ФФП Г Г Г Г кФФФФФФ Disable AT Command Set Verbal result codes ФФП Г Г Г Г Г Г кФФФФФФФ Disconnect With +++ DTR normal ФФФФФФФФФП Г Г Г Г Г Г Г Г кФФФФФ Load NVRAM Defaults Г Г Г Г Г Г Г Г Г ...

Еще в разделе: (Показать все результаты (>1384) - crydee.sai.msu.ru/ )

• Image: Column is made of single tree.
• Image: Golden lanterns among orange columns.
• Image: Column near piazza S. Trinita.

This module provides for determining the MIME type of a file by looking at a few bytes of its contents. ... string . ... belong . ... For example, this can recognize gzipped files and set the encoding for them. # gzip (GNU zip, not to be confused with [Info-ZIP/PKWARE] zip archiver) 0 string \037\213 application/octet-stream x-gzip This module is not for every system. ... When compiling an Apache server, this module should be at or near the top of the list of modules in the Configuration file. ...

Еще в разделе: (Показать все результаты (>64) - neptun.sai.msu.ru/ )

• Apache suEXEC Support
• Compiling Apache for Microsoft Windows
• Manual Page: apxs - Apache HTTP Server

... О UNИX . ... HelpOnMoinCommand . ... You can also setup logging there if you don't like the builtin logging configuration. usage: moin [ command ] [general options] command subcommand [specific options] options: --version show program's version number and exit -h, --help show this help message and exit ... informational messages) --show-timing Show timing values [default: False] --config-dir=DIR Path to the directory containing the wiki configuration files. [default: current directory] -- ...

Еще в разделе: (Показать все результаты (>144) - uneex.mithril.cs.msu.su/ )

• HelpOnTables - UNИX
• Index of /static/AltDocs_informatika1/Book1/2_os/1_linux/04_command
• WikiCourse/15 Tables - UNИX

. Description . Annotation database for human . Annotation database for mouse . Annotation database for rat Partially suppurted by RFBR grant 10-07-00685-а . Ramil Nurtdinov

Еще в разделе: (Показать все результаты (>14) - monkey.belozersky.msu.ru/ )

• SDPpred

... Главная -> Фильмы -> Second in Command . ... Фильмы . ... Second in Command . Второй в команде . Румыния - США 2006 . ... Правой рукой посла СШАљДжорджа Норлэнда стал офицер-спецназовец СэмљКинен, присланный вљстрану дляљукрепления обороны посольства.После гибели Норлэнда волею судьбы Сэмљдолжен былљпринять командование наљсебя. ... Наљего сторонељ? несколько десятков морских пехотинцев, против негољ? несколько тысяч разъяренных вооруженных мятежников? [ klepa ] . ...

Еще в разделе: (Показать все результаты (>147) - kinfo.ru/ )

• Command & Conquer: Renegade - Фильмы - Kinfo.ru
• Master and Commander: The Fa.. - Фильмы - Kinfo.ru
• Commander in Chief - Фильмы - Kinfo.ru

... Полная версия этой страницы: Cortex Command . Студенческий форум Физфака МГУ > Общий > Все обо всем > Юмор, развлечения, игрушки.. ... Если возникла необходимость убить некоторое количество времени - Cortex Command это то, что нужно. ... 21.1.2008, 21:44 . ... Для просмотра полной версии этой страницы, пожалуйста, пройдите по ссылке . Русская версия IP.Board 2001-2016 IPS, Inc. ...

Еще в разделе: (Показать все результаты (>88) - wasp.phys.msu.ru/ )

• Cortex Command - Студенческий форум Физфака МГУ

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... дайте скачать Command and Conquer . ... Re: дайте скачать Command and Conquer [ re: Kach ] . ... Re: дайте скачать Command and Conquer [ re: alien ] . ...

Еще в разделе: (Показать все результаты (>490) - www.snto-msu.net/ )

• pptp-command: command not found ...К чему бы это? - Public forum of MSU united
• есть ли Total Commander портированный в linux? - Public forum of MSU united
• Outlook и HELO command - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... дайте скачать Command and Conquer . ... Re: дайте скачать Command and Conquer [ re: Kach ] . ... Re: дайте скачать Command and Conquer [ re: alien ] . ...

Еще в разделе: (Показать все результаты (>875) - www.fds-net.ru/ )

• есть ли Total Commander портированный в linux? - Public forum of MSU united
• Outlook и HELO command - Public forum of MSU united student networks
• WinXP Pro SP2 (NTFS) - Dos (norton Commander) меню - Public forum of MSU united

I.M. Maksimova, E.I. Morosanova, Yu.A. Zolotov . Mendeleev Commun., (4), p. 146-147 (1995) . ABSTRACT . A capillary tube with a hydrophobic inner surface, which was non-covalently coated on-line with quinalizarin, has been used for the simultaneous determination of Ca and Mg by segmented-flow analysis. Laboratory of Preconcentration

Еще в разделе: (Показать все результаты (>110) - chem.msu.ru/ )

• Single-column method of chelation ion chromatography for the analysis of trace
• Separation selectivity of some ethylenediaminetetraacetic acid and
• Moscow University Chemistry Bulletin Vol. 52, No. 6, P. 426 (2011)

1) Faculty of Soil Science, Moscow State University, Moscow 119899, Russia; . ... We assessed critical loads of acid deposition and their exceedance for soils in the Kola Peninsula using a simple balance method and mapped them within 1.0° · 0.5° longitude/latitude grid cells. ... Terrestrial ecosystems in the north-western Kola Peninsula are particularly susceptible to acid deposition damage due to relatively high soil sensitivity and heavy sulphur deposition. back . ...

Еще в разделе: (Показать все результаты (>32) - eco.soil.msu.ru/ )

• EFFECTS OF ACID DEPOSITION ON ACIDITY IN PODZOLS
• CRITICAL LOADS OF ACID DEPOSITION IN EUROPEAN RUSSIA
• SIMULATION OF ACID SNOW AND RAIN IMPACT ON FORESTS

Comparative deep sequencing survey of alternative splicing in human and mouse D. Pervouchine, S. Djebali, A. Breschi, J. Lagarde, T. Gingeras, R. GuigС We perform comparative analysis of alternative splicing by using RNA-seq data in 16 human cell lines and 30 mouse tissues. ... Despite having biologically different samples the variability of splice junction usage is to large extent conserved between human and mouse. ...

Еще в разделе: (Показать все результаты (>84) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/128.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/171.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/236.pdf

.

Еще в разделе: (Показать все результаты (>4) - www.chemport.ru/ )

• Guard column PolyspherR CH CA, for HPLC, (крупная уп.) - компании-поставщики

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Key-words: rhythm, stress, syllable, rhythmic structure, syntagm, utterance, prosody, speech production, speech perception . ... In speech communication, RS are both units of speech production and speech perception. ... The research of speech rhythm in diachrony and synchrony consists of the analysis and the description of speech rhythmic units concerning Old Church Slavonic, Old Russian, Old High German in diachrony and Modern Russian, German, Czech and Bulgarian in synchrony. ...

Еще в разделе: (Показать все результаты (>68) - www.philol.msu.ru/ )

• LangueDOC :: Tools :: Text conversions
• GeoIntroduction
• NepaliIntroduction

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Pivovarov A.S. , Murzina G.B. , Makhnovsky D.A. , Tret?yakova M.S. в журнале World Journal of Neuroscience , издательство Scientific Research Publishing, Inc. ... Авторы: Pivovarov A.S. , Abramova M.S. , Makhnovsky D.A. , Palikhova T.A. 5th FENS Forum, 8-12 July 2004, Vienna , Vienna, Австрия, 8-12 июля 2006 . ...

Еще в разделе: (Показать все результаты (>119) - istina.msu.ru/ )

• Nurtdinov R.N. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Abakumova G.M. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Burdin A.M. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического