... Submit your article . ... Public Administration publishes scholarly articles on theory, methodology and practice of management, results of applied research projects in administration, studies of Russian and foreign administration experience, bibliographical reviews and information on conferences, round tables and workshops. ... The journal accepts polemic articles. ... All articles submitted for publication are first reviewed for compliance with the guidelines for article formatting and content. ...

Еще в разделе: (Показать все результаты (>570) - ee-journal.spa.msu.ru/ )

... Directives | ... Apache HTTP Server Version 2.0 . ... This document describes the files used to configure the Apache HTTP server. ... Scope of Directives .htaccess Files . ... Apache is configured by placing directives in plain text configuration files. ... Directives placed in the main configuration files apply to the entire server. ... The server administrator further controls what directives may be placed in .htaccess files by configuring the AllowOverride directive in the main configuration...

Еще в разделе: (Показать все результаты (>654) - uneex.lorien.cs.msu.su/ )

• mod_auth_dbm - Apache HTTP Server
• HelpOnMacros/Include - UNИX
• Configuration Sections - Apache HTTP Server

... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...

Еще в разделе: (Показать все результаты (>26) - www.anthropos.msu.ru/ )

... Scope of Directives .htaccess Files . ... Apache is configured by placing directives in plain text configuration files. ... Any directive may be placed in any of these configuration files. ... Apache configuration files contain one directive per line. ... Directives placed in the main configuration files apply to the entire server. ... The server administrator further controls what directives may be placed in .htaccess files by configuring the AllowOverride directive in the main configuration files....

Еще в разделе: (Показать все результаты (>124) - neptun.sai.msu.ru/ )

• Apache module mod_auth_dbm
• Apache Tutorial: Introduction to Server Side Includes
• Apache module mod_info

... NASA , NSF Explanation: Is our Earth unique? In continuing efforts to answer this question, astronomers have now discovered an Earth-like planet orbiting a distant normal star. ... Slight, fast, but regular wobbles of nearby small M - dwarf star Gliese 876 showed evidence for a planet with a likely mass slightly higher than a minimum six times the mass of Earth. ... Publications with keywords: planets - Earth - Gliese 876 . Publications with words: planets - Earth - Gliese 876 . ...

Еще в разделе: (Показать все результаты (>15685) - www.astronet.ru/ )

• Астронет > Gliese 876 System Includes Large Terrestrial Planet
• Lunar Time Lapse Panorama including Yutu Rover
• Астронет > Lunar Time Lapse Panorama including Yutu Rover

... Effect of Alkylating Agent on the Efficiency and Selectivity of New Polymer-based Anion Exchangers . Abstract New anion-exchangers for ion chromatography with functional groups of trimethylammonium and 3-chloro-2-hydroxypropyl-N,N-dimethylammonium were obtained. ... Moscow University Chemistry Bulletin . 2011, Vol. ... 5, P. 375 . Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>1480) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 48, No. 4, P. 245 (2007)
• Moscow University Chemistry Bulletin Vol. 45, No. 2, P. 124 (2004)
• Moscow University Chemistry Bulletin Vol. 46, No. 1, P. 29 (2005)

... What Is Not Included In The Standard? Up: Introduction to MPI Next: Organization of this Document Previous: What Is Included In The Standard? The standard does not specify: . ... Operations that require more operating system support than is currently standard; for example, interrupt-driven receives, remote execution, or active messages . ... There are many features that have been considered and not included in this standard. ... Return to MPI Standard Index . ... Центры . ...

Еще в разделе: (Показать все результаты (>739) - www.parallel.ru/ )

• What Is Included In The Standard? | PARALLEL.RU - Информационно-аналитический
• Heterogeneous networks of multicomputers and the ch_nexus device | PARALLEL.RU
• Organization of this Document | PARALLEL.RU - Информационно-аналитический центр

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>75) - electr003.chem.msu.ru/ )

Ultraviolet data (DUV) . ... The section "Original data" contains original information in analogue-digital and digital- analogue codes. The section "Data for analysis" contains pre-processed data for further analysis. Tatiana" program can be used for graph presentation of the experimental data, and "Orbitron" program - for geographical control of the data. Manual on how to use the programs and the data is in the HELP-file. ... Original data . Data for analysis . Tatiana program . ...

Еще в разделе: (Показать все результаты (>215) - cosmos.msu.ru/ )

New Install 1. Create the new cacti database shell> mysqladmin -p --user=root create cacti 2. Import the default cacti database: shell> mysql -p --user=root cacti < ${MY_INSTALLDIR}/cacti.sql 3. Create a MySQL username and password for cacti. shell> mysql -p --user=root mysql mysql> GRANT ALL ON cacti.* ... Edit ${MY_INSTALLDIR}/include/config.php and modify the MySQL user, password and database for your cacti configuration. ...

Еще в разделе: (Показать все результаты (>31163) - mirror.msu.net/ )

• RFC Editor Reports at IETF
• FYI: 15

... HelpOnMacros/Include . ... Include(pagename, heading, level, from="regex", to="regex", sort=ascending|descending, items=n, skipitems=n, titlesonly, editlink)>> . ... Text for the generated heading which will link to the included page (optional). level . ... Include the text of page FooBar in the current paragraph: <<Include(FooBar)>> . ... Sort the page list in descending order: <<Include(^FooBar/.*, , sort=descending)>> . Include a maximum of three pages: <<Include(^FooBar/.*, , items=3)>> . ...

Еще в разделе: (Показать все результаты (>265) - uneex.mithril.cs.msu.su/ )

• HelpOnParsers/ReStructuredText - UNИX

... The LanHEP input file is the sequence of statements, each starts with a special identifier (such as parameter, lterm etc) and ends with the full-stop ' . ... This section is aimed to clarify the syntax of LanHEP input files, i.e. the structure of the statements. ... Let us consider the LanHEP input files for the Standard Model with both the t'Hooft-Feynman and unitary gauges. ... LanHEP allows the user to define several keys , and use these keys to branch among several variants of the model. ...

Еще в разделе: (Показать все результаты (>2907) - theory.sinp.msu.ru/ )

• Interaction vertices
• Publishing Offices
• CompHEP/SUSY

... Другие названия журнала: Advances in Space Research (includes Cospar Information Bulletin , Advances in Space Research(includes Cospar Information Bulletin) . ... Lipunov V. в журнале Advances in Space Research (includes Cospar Information Bulletin) . ... Sajid M. , Chechenin N.G. , Torres F.S. , Khan E.U. , Agha S. в журнале Advances in Space Research (includes Cospar Information Bulletin) , том 56, с. 314-324 DOI . ...

Еще в разделе: (Показать все результаты (>1608) - istina.msu.ru/ )

• Virchows Archiv. B, Cell pathology including molecular pathology - журнал |

... Glutathionylation of the alpha-subunit of Na,K-ATPase from rat heart by oxidized glutathione inhibits the enzyme. ... A partially purified Na,K-ATPase preparation from rat heart containing alpha1- and alpha2-isoforms of the enzyme was shown to include both subunits in S-glutathionylated state. Glutathionylation of the alpha1-subunit (but not of the alpha2-subunit) was partially removed when the preparation was isolated in the presence of dithiothreitol. ...

Еще в разделе: (Показать все результаты (>171) - biochem.bio.msu.ru/ )

• Carnosine as a natural antioxidant and geroprotector: from molecular mechanisms

... Коллекция публикаций о времени, собранная Семинаром . J. T. Fraser. A Report on the Literature of Time, 1900-1980< . ... The Study of Time IV, 1981, Springer-Verlag, pp. ... The entries were selected by the standard of whether they do, in some ways, extend the concerns of the papers included in the four volumes of The Study of Time. ... There seems to be sufficient material in the periodical literature to supply a comparable number of entries for a multidisciplinary bibliography of time. ...

Еще в разделе: (Показать все результаты (>398) - chronos.msu.ru/ )

What would you like to search for? ... Case sensitive Match whole word Recent publications first . ... What to do if you are looking for ... words iron and oxide in the same record: iron and oxide . both these words or chemical formulae: (iron and oxide) or Fe2O3 . ... That's why do not use Co instead of cobalt : you will find Co even in al co hol! ... The hidden part of the database allows you to use full names of chemical elements instead of the short ones (like nickel instead of Ni ). ...

Еще в разделе: (Показать все результаты (>4) - scon155.phys.msu.ru/ )

• Database: publications on x-ray absorption spectroscopy

IMPALA: Integrating Matrix Profiles And Local Alignments 1. ... Primary preprocessing Prepare the following files : i. a collection of PSI-BLAST-generated profiles with arbitrary names and suffix .chk; ii. a collection of profile master sequences , associated with the profiles , each in a separate file with arbitrary name and a 3 character suffix starting with c; the sequences can have deflines; they need not be sequences in nr or in any other sequence ...

Еще в разделе: (Показать все результаты (>1922) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/FBB/year_04/doc/BLAST_help/formatrpsdb.html
• Help: hgignore
• TracUpgrade тАУ Tanchiki

.

Еще в разделе: (Показать все результаты (>298) - comet.sai.msu.ru/ )

• Including text in a shell script
• Removing directories
• Special Characters

... Salmonella typhimurium LT2, section... 147 9e-36 >AE008909 AE006468 |AE008909| ... Sbjct: 9915 aaacataaagtgatcgccagctgctttttcgaagcctc 9878 Database : fg Posted date: Dec 18, 2007 6:08 PM Number of letters in database : 12, 243 ,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 21,910 Number of extensions: 1351 ...

Еще в разделе: (Показать все результаты (>19494) - kodomo.fbb.msu.ru/ )

• allpy: 3a712982ceb8
• Help: hgignore
• allpy: 69079d72d207 allpy/markup.py

and 42 % 27-11-1999 Andr\'as Holl % 2.31: 02-05-2001 % % Konkoly Observatory, Budapest, Hungary % Use the following documentstyle definition : % \documentstyle[twoside, ibvs2, epsf]{article} % or % \documentstyle[twoside]{article} % \input ibvs2.sty % \input epsf.sty % epsf is only needed for figures % IBVS.STY screen message \ typeout {} \ typeout {IBVS.STY Ver. 2.31 - 02-05-2001 } \ typeout {Information Bulletin on Variable Stars - Konkoly Observatory} \ ...

Еще в разделе: (Показать все результаты (>94) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description