Катрич Н.С. The evolution of phylogenetic system and ecology // E-Conference Evolution and Biodiversity: The evolutionary basis of biodiversity and its potential for adaptation to global change 1st 19th March 2010 (электронная конференция: http://win.mail.ru/cgi-bin/msglist?folder=0 2145270639#/cgi-bin/readmsg_Q_id=1269011137000000027 8 =0 . ...

Еще в разделе: (Показать все результаты (>71) - srcc.msu.ru/ )

• T.G.Arshakian, R.Beck, M.Krause, D.Sokoloff Evolution of magnetic fields in
• D.Sokoloff, Galaxy formation and evolution by Houjun Mo, Frank van den Bosch
• D.Sokoloff Galaxy formation and evolution by Houjun Mo, Frank van den Bosch and

Mathematical modeling of the 3D evolution problem for the interface between liquids of different viscosity and density in a uniform and infinite soil" . Nikolsky D.N. The three-dimensional evolution problem for the interface between liquids of different viscosity and density is formulated for the case of piston displacement. ...

Еще в разделе: (Показать все результаты (>60) - num-meth.srcc.msu.ru/ )

• "The Fortran programming language evolution (1957-2007) and the prospects of
• "Modeling of magnetorotational instability evolution using a parallel RKDG
• "Simulation of a molecular structure formation as a result of thermal

ttcatgagcgtcttcattgaaggggtagaaaaagatcgggtacaggtccagctttctaac ggtacgaccttctggatccctgtcgatggcaccactgtcactcgtggagaacgcatgtca ctcggcattcgtcctgaacatttggtcgaagcagagcatggcgatgccaaaattgaaggc aaagtaatgatcgttgagaaactgggtaacgaaacccaagtgtatatgaacctgaagggt tcagactcagatgtgatctaccgccagccagacacactcgatgtcgaaaccggtgacacg ctcaccattggtattcccgcacatcgctgccatctattccacagtgatggccgtgcttgc cgccgtttacataaagaaaaaggcgtt Synonymous (KS) and non-synonymous (KA) substitution rates calcualted by ... Molecular Biology 11:725-736. ...

Еще в разделе: (Показать все результаты (>575) - kodomo.cmm.msu.ru/ )

• Practice1(evolution)
• evolution
• Possible gene's evolution

... The Evolution of the Russian Tax System in the 19thcentury, . ... Ezhegodnik (Economic Hystory. ... 2002 , Moscow: ROSSPEN, 2003, p.345-383. ... The article deals with the history of the taxes of the Russian empire in the 19th century. ... Despite of the lag with the European model which consisted in the absence of income taxation, the Russian tax system had provided the budget with monetary resources, that were necessary for the financial stability of the Empire. ...

Еще в разделе: (Показать все результаты (>96) - hist.msu.ru/ )

• Project "The Labour Relations Evolution in Russian Industries"

... G. A Leikin, A. N. Sanovich. Sternberg Astronomical Institute, Moscow 119899, Russia. Brown University - Vernadsky Institute Microsymposium 34, October 8-9, 2001, Moscow, Russia . ... G. A. Leikin and A. N. Sanovich, Sternberg State Astronomical Institute, Moscow State University, . ... Brown University - Vernadsky Institute Microsymposium 38, October 27-29, 2003, Moscow, Russia . ... Sternberg State Astronomical Institute, Moscow, State University, 119992, Moscow, Universitetskij prosp. ...

Еще в разделе: (Показать все результаты (>56) - selena.sai.msu.ru/ )

• Anatoly N. Sanovich

... Journal of Molecular Evolution [ J Mol Evol] . Common information . ... 1432-1432 . ... since 1971-03-01 till today . ... biology ->evolution . ... http://elibrary.ru/title_about.asp?id.. ... http://www.springer.com/journal/00239.. ... 1971-03-01 . today . ... http://www.springerlink.com/content/1... 2000-09-01 . ... http://elibrary.ru/issues.asp?id=2212 . ...

Еще в разделе: (Показать все результаты (>267) - journals.genebee.msu.ru/ )

• JCatalog - Список журналов

... Serafim Batzoglou (Stanford University, USA) "Genome evolution during progression to breast cancer" . Vadim Gladyshev (Brigham and Women's Hospital, Harvard Medical School, Boston, USA) "Understanding aging and control of lifespan through genome analyses" . ... Shamil Sunyaev (Harvard Medical School, Boston, USA) "Human germ line and somatic mutation rates: evolution, biology and statistical" . ... MCCMB'13, 2013 ...

Еще в разделе: (Показать все результаты (>267) - mccmb.belozersky.msu.ru/ )

• Program of MCCMB'05

CALCULATION OF THE PARAMETERS OF MICROSCOPIC OPTICAL POTENTIAL BY ASYNCHRONOUS DIFFERENTIAL EVOLUTION ALGORITHM Zhabitskaya E.I ., Zhabitsky M.V.1 , Zemlyanaya E.V., Lukyanov K.V. Dubna University, Russi, Dubn; Joint Institute for Nuclear Research, LIT, Russia, Dubna ,141980, Joliot-Curie 6 Joint Institute for Nuclear Research, LNP, Russia, Dubna ,141980, Joliot-Curie 6; Rock Flow Dynamics, Russi, Moscow 1 Differential ... J. of Global Optimization 11,1997, Pp. ...

Еще в разделе: (Показать все результаты (>89) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc150820/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc98332/eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc27224/doc.pdf

The в??developmental conduitв?? of the tribe Microtini (Rodentia, Arvicolinae): Systematic and evolutionary aspects . ... P.104-118 [in Russian, with English summary]. ... Anatomy of the arvicoline radiation (Rodentia): palaeogeographical, palaeoecological history and evolutionary data // Annales Zoologici Fennici. ... Molecular phylogeny of the speciose vole genus Microtus (Arvicolinae, Rodentia) inferred from mitochondrial DNA sequences // Molecular Phylogenetics and Evolution. ...

Еще в разделе: (Показать все результаты (>990) - zmmu.msu.ru/ )

• A preliminary study on molecular phylogeny of giant flying squirrels, genus
• Genetic and cytogenetic variation of African root-rats Tachyoryctes splendens
• Little genetic divergence of the greater horseshoe bat Rhinolophus

... Эволюция Афгано-Таджикской депрессии: . от задугового бассейна до транспрессивного складчатого сооружения . ... Наиболее вероятно, что высокие скорости порождаются присутствием на глубине океанской коры. ... В это время происходит морфологическое оформление дуги поднятий ЮЗ Гиссара - Южного Гиссара на фоне интенсивного утонения коры и прогибания в области собственно Таджикской депрессии; в целом задуговый бассейн приобретает отчетливое сходство с такой структурой как Паннонская впадина. ...

Еще в разделе: (Показать все результаты (>423) - geo.web.ru/ )

• Геодинамическая и тектоническая эволюция Карпатской дуги и ее форланда
• Modes of transform faults evolution
• Informal geological society (RSG SG )

... 2015 . ... Graduate student, Political History Department, School of Public Administration, Lomonosov Moscow State University. ... This article examines the evolution of the cadre of the regional leadership of the RSFSR in 1930 1941. The focus is on the social characteristics of the first secretaries of regional committees of the CPSU(b). ... There are two generations of first secretaries who worked in 1930 s: those who joined the office in 1917 1936, and those who did in 1937 1941. ...

Еще в разделе: (Показать все результаты (>24) - ee-journal.spa.msu.ru/ )

... lcn:centos5 ]] . THEP . ... добавить в .bashrc (или аналогичный для вашего шелла): mkdir -p /var/tmp/`id -nu`-ffcache > /dev/null 2>&1 . ... CentOS 5.3 i386 + soft: OpenOffice.org 3.0 инфра-ресурс Adobe Reader 9 Adobe Flash Player JRE + firefox plugin mplayer gstreamer-plugins-ugly vlc thunderbird truetype fonts alpine latex xdvi xpdf gv vim X11 gparted tcsh mc . ... Добавить репозиторий для yum rpm -Uhv http://apt.sw.be/redhat/el5/en/i386/rpmforge/RPMS/rpmforge-release-0.3.6-1.el5.rf.i386.rpm . ...

Еще в разделе: (Показать все результаты (>270) - theory.sinp.msu.ru/ )

• lcn:f10 [THEP]
• lcn:f9 [THEP]

... Criteria of branch quality . As it was repeatedly told , phylogenetic trees consist from branches. ... I. e., those positions, which can separate sequences of the branch from other sequences in the alignment. ... Measure of branch separation . ... Here and further: A - branch of the tree, i , j - sequences of alignment . ... That's why number of conserved positions in some branch should be considered in complex with the distribution of conserved positions in the whole alignment. ...

Еще в разделе: (Показать все результаты (>101) - monkey.belozersky.msu.ru/ )

• Inquiry information || Parsimony algorithm

Tevelev, Arc. ... Region that transsected by 'Urseis '95' includes four principal recent morphological units: (1) Pre-Uralian foredeep (subsident margin of the East European platform), (2) mountain building of the Western and Central Urals (overprinted and uplifted platform margin ); (3) East Uralian Plateau , (topographically smoothed and relatively low-level collage of oceanic, island arc and microcontinental terraines); (4) western margin of the West Siberian ...

Еще в разделе: (Показать все результаты (>18) - sbmg.geol.msu.ru/ )

• Ссылки на сейсмотомографические сайты

FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...

36. Russian Interdisciplinary Temporology Seminar

37. Konferences

38. Abstract

39. http://xray.sai.msu.ru/~polar/sci_rev/1403.html

40. Публикация