This module provides for documents with Server Side Includes (SSI). ... Any document with handler of "server-parsed" will be parsed by this module, if the Includes option is set. If documents containing server-side include directives are given the extension .shtml, the following directives will make Apache parse them and assign the resulting document the mime type of text/html : AddType text/html .shtml AddHandler server-parsed .shtml The following directive must be given for ... cgi . ...

Еще в разделе: (Показать все результаты (>118) - neptun.sai.msu.ru/ )

• Apache Tutorial: Introduction to Server Side Includes
• Apache module mod_example
• Apache Tutorial: .htaccess files

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>183) - www.geogr.msu.ru/ )

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>17) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

A Quick Guide To UNIX This is an introduction to the UNIX operating system. ... More information on the options, the effects and how to use the commands is available by using the man command : man gives manual information on a topic man grep displays the manual page about grep Another useful source of information is the on-line EMBnet tutorial which includes a page on UNIX FILES ls more lists files in a directory ls -alF lists -a all ...

Еще в разделе: (Показать все результаты (>2326) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/TracUnicode?format=txt
• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/TracUnicode?version=1&format=txt
• Help: hgignore

... Астронет | ... Gliese 876 System Includes Large Terrestrial Planet . ... In continuing efforts to answer this question, astronomers have now discovered an Earth-like planet orbiting a distant normal star. Previously over 150 gas-giant planets like Jupiter had been so discovered. ... The planet's small mass indicates that it is likely terrestrial in nature, similar in composition to the inner planets of our Solar System . ... The newly discovered terrestrial-like planet is depicted in the insert. ...

Еще в разделе: (Показать все результаты (>8086) - www.astronet.ru/ )

• Gliese 876 System Includes Large Terrestrial Planet
• Lunar Time Lapse Panorama including Yutu Rover
• Астронет > Lunar Time Lapse Panorama including Yutu Rover

... Minimal size of Clud clusters (residues) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Hydrophobic cluster of a single protein structure is a separated pool of nonpolar atoms. Usually there is the biggest cluster in the protein called hydrophobic core. ... ConClus program is able to detect of conservative hydrophobic clusters for a family of related protein domains or just for a set of aligned proteins. ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

Name Last modified Size Description . Parent Directory - top.htm 01-Nov-2010 03:19 305 . Apache Server at genphys.phys.msu.su Port 80

Еще в разделе: (Показать все результаты (>17) - genphys.phys.msu.su/ )

. Name . Last modified . Size . Description . Parent Directory . - . DB_functions.pm . 31-Oct-2005 10:41 . 529 . dbcon.msn . 31-Oct-2005 10:41 . 602 . dump.mysql . 31-Oct-2005 10:41 . 960 . forum/ . 31-Oct-2005 10:41 . - . redirect.msn . 31-Oct-2005 10:41 . 206 . Apache/2.2.16 (Debian) Server at www.kosmofizika.ru Port 80

Еще в разделе: (Показать все результаты (>55) - www.kosmofizika.ru/ )

• Index of /includes/forum

. Name . Last modified . Size . Description . Parent Directory . - . Apache/2.4.10 (Debian) Server at 127.0.0.1 Port 88

Еще в разделе: (Показать все результаты (>219) - herba.msu.ru/ )

• Index of /shipunov/school/biol_448/nd_keys/nd_labiatae/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_polygonaceae/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_compositae/includes

. [ Войти ] . Главная -> Фильмы -> Parrot Sketch Not Included: .. Пользователи . Демо . Деньги . Фильмы . Форум . Parrot Sketch Not Included: Twenty Years of Monty Python . Неизвестные Скетчи Монти Пайтон . Великобритания 1989 . отметить . Комедия . Ian MacNaughton . Steve Martin . Graham Chapman . John Cleese . Terry Gilliam . Eric Idle . Terry Jones . Michael Palin . Carol Cleveland . Connie Booth . Basil Tang . Marjorie Wilde . The Fred Tomlinson Singers .

Еще в разделе: (Показать все результаты (>18) - kinfo.ru/ )

• *batteries not included - Фильмы - Kinfo.ru

... The first line of each paragraph should be indented by 0.63 cm except for paragraphs that follow a white space (e.g., after a heading, example, table or figure). ... References to examples in the text should take the form "see (1a) and (1b)" with both number and letter in brackets. ... 2.6 Pagination There should be no orphaned example numbers, that is, example numbers with corresponding text on the following page; page breaks in definitions or between examples and glosses, etc. ...

Еще в разделе: (Показать все результаты (>293) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/fdsl/FDSL7.5-stylesheet.doc
• LangueDOC :: Tools

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>375) - www.mmonline.ru/ )

• MMOnline | Развлечения | Эволюция Программиста
• MMOnline | Новости | Эволюция Программиста

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MinGW + QT [Windows] траблы с include-директориями . ... как настроить MinGW, чтобы он меня видел? ... Re: MinGW + QT [Window] траблы с include-директориями [ re: StepLg ] . ...

Еще в разделе: (Показать все результаты (>3045) - www.fds-net.ru/ )

• Re: На злобу дня - Public forum of MSU united student networks
• Как передать параметр в g++ к исходнику - Public forum of MSU united student
• [c++] возможно ли произвольное число циклов без рекурсии? - Public forum of MSU

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... MinGW + QT [Windows] траблы с include-директориями . ... как настроить MinGW, чтобы он меня видел? ... Re: MinGW + QT [Window] траблы с include-директориями [ re: StepLg ] . ...

Еще в разделе: (Показать все результаты (>2436) - www.snto-msu.net/ )

• iostream - Public forum of MSU united student networks
• Re: На злобу дня - Public forum of MSU united student networks
• Re: юмор в этом разделе - Public forum of MSU united student networks

... Natalya V. Raguzova and Sergei B. Popov . ... We present a compilative catalogue of Be/X-ray binaries and candidates in the Galaxy and in the Large and Small Magellanic Clouds. This catalogue contains 160 sources and provides information on names and spectral types of optical components, distances, on spin characteristics of neutron stars, and on orbital and X-ray properties of binary systems. ... Be/X-Ray Binaries and candidates in the Galaxy . Galactic sources: comments to the Table 1 . ...

Еще в разделе: (Показать все результаты (>421) - xray.sai.msu.ru/ )

• PROBLEMS OF THEORETICAL COSMOLOGY - UISS2000
• My Favourite music
• Ejectors in Massive Binary Systems

... Academic Departments . ... Partners . ... All partners . ...

Еще в разделе: (Показать все результаты (>64) - www.journ.msu.ru/ )

• Faculty of Journalism, Lomonosov Moscow State University was included in the
• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• Russian Media and Journalism International Programme :: Department of

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>187) - www.genebee.msu.ru/ )

• GEA :: Gene Expression Analysis

... Supercomputer molecular modeling of thermodynamic equilibrium in gas-metal microsystems" . Podryga V.O., Polyakov S.V., and Puzyrkov D.V. This paper is devoted to the supercomputer modeling of thermodynamic equilibrium in microsystems containing different substances in various aggregate states. ... Podryga V.O. тАУ Keldysh Institute of Applied Mathematics, Russian Academy of Sciences; Miusskaya ploshchadтАЩ 4, Moscow, 125047, Russia; Ph.D., Scientist, e-mail: pvictoria@list.ru . ...

Еще в разделе: (Показать все результаты (>175) - num-meth.srcc.msu.ru/ )

• "A quasi-3D model of a polymer electrolyte fuel cell"
• "Numerical aspects of the calculation of scaling factors from experimental...
• Numerical Methods and Programming.Advanced Computing

fitshdr - FITS-file headers manipulation tool fitshdr [options] [FITSfile_name] . ... fitshdr [options] --edit FITSfile_name . ... If You want to modify headers of FITSFILE using new FITS-header lines from HEADER file (or from stdin), You have to use this option (You can skip this option, if -H or --header option is used). ... Empty header lines are not displayed (in 'dump' mode only). --line-offsets . ... In 'dump' mode: file offset will be displayed for each header line. --no-line-offsets . ...

Еще в разделе: (Показать все результаты (>302) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR_EDIT
• FITShdr: FITS header viewer/editor
• ...Some useful software links...