Next: Implementation Overview Up: Separating client and server Previous: Naming Service . ... IDL:Account:1.0 . ... 1: // file account _server2.cc 2: 3: #include account .h 4: 5: class Account _impl : virtual public Account _skel 6: { 7: // unchanged, see section MICO Application 8: // ... 9: }; 10: 11: 12: int main( int argc, char *argv[] ) 13: { 14: // ORB initialization 15: CORBA :: ORB _var orb = CORBA :: ORB _init( argc, argv, mico -local- orb ); 16: CORBA :: BOA _var boa = ...

Еще в разделе: (Показать все результаты (>1067) - rtm-cs.sinp.msu.ru/ )

• Issues Regarding DNS and Apache
• Apache module mod_log_referer
• Apache HTTP Server: Notes about Compatibility with NCSA's Server

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>6) - tex.bog.msu.ru/ )

• http://tex.bog.msu.ru/rustexeo.html

You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... parsePatch($file ) -> %patch{filename} . ... updateFile($file, $patch, $reverse ) . ... Each patch file can patch one or more files. ... md5_of_target} = Will match the file version that can accept this patch. {patched} = Expected MD5 of the patched file. {version} = Comment from PATCH record describing the target. ... Patch target . ... Applies to . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• HistoryPlugin < System < Foswiki
• JQueryLoader < System < Foswiki

Unfortunately, the English version of our site is much less developed than the Russian version. ... Library of Electronic Publications . ... The Institute for Time Nature Explorations web site is established by the Russian Interdisciplinary Temporology Seminar , which has been operating at M. V. Lomonosov's Moscow State University since 1984. The creation and continued maintenance of the institute were and are made possible through the support of the Russian Fund of Basic Research, grant No. ...

Еще в разделе: (Показать все результаты (>549) - chronos.msu.ru/ )

• Home - Institute for Time Nature Explorations
• Laboratory-chair of modelling the natural references of time
• On the Way to Understanding the Time Phenomenon: the Constructions of Time in

New GCVS Versions for Three Southern Constellations Peremennye Zvezdy (Variable Stars) 27, No. ... We are currently working on a version of the General Catalogue of Variable Stars (GCVS) revised taking into account the new data accumulated since the 4th GCVS edition. ... It will contain all stars of the 4th GCVS edition plus a complete catalogue of the stars added to the GCVS in the Name Lists of Variable Stars Nos. ...

Еще в разделе: (Показать все результаты (>134) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>402) - www.rochesterastronomy.org/ )

• Bright Supernova Bright Supernova - links

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>283) - www.geogr.msu.ru/ )

О факультете . ... Социологические школы и олимпиады . ... Вестник МГУ . ... МГУ, д. 1. стр. ... English version . ... Programs for foreign students . ... Contacts Faculty of Sociology was founded on June 6, 1989. ... Hence the faculty offers the best educational programs to meet the needs of international students and requirements of contemporary sociology and employment standards in today?s dynamic and changing world. ... PhD programs The faculty provides studies for bachelor's degree in Sociology. ...

Еще в разделе: (Показать все результаты (>94) - www.socio.msu.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Depth maps contain uniform areas and very good compression rates are achieved. Depth maps have very good correlation with 2D image so this information is used for 3D video compression. ... Reference codec: H.264 MVC from Intel Media SDK version 3.5.915.45249 (high quality preset) . ... Keyframe-based Depth Compression . Keyframe-based Depth Compression with Depth Propagation for Multiview Video Coding . ...

Еще в разделе: (Показать все результаты (>284) - graphics.cs.msu.ru/ )

• Keyframe-based Depth Compression (Update) | Лаборатория компьютерной графики и
• GML AdaBoost Matlab Toolbox | Лаборатория компьютерной графики и мультимедиа
• GML MatLab Camera Calibration Toolbox | Graphics and Media Lab

. Homepage . Belozersky Institute . GeneBee . Russian EMBnet Node . Screening protein sequence against PROSITE databank . Help . References . Your E-mail address . Query sequence name . Sophisticated Version . Query sequence (without name) . Last updated - August 14, 2000. Any comments or suggestions are welcomed at: nik@genebee.msu.su

Еще в разделе: (Показать все результаты (>202) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• Fasta3 help
• RNA secondary structure prediction

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>104) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - FAST MATRIX DIAGONALIZATION AND INVERSION
• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - TDDFT

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>24) - uranus.sai.msu.ru/ )

• Anatol Cherepashchuk
• Igor Antokhin
• Irina Glushneva

npidb:// home / introduction . Russian version of this document . The database NPIDB (Nucleic acid ? Protein Interaction DataBase) contains information derived from structures of DNA-protein and RNA-protein complexes extracted from Protein Data Bank (PDB) (1932 complexes in the end of 2007). ... Provide an essential information on structural features of DNA-protein and RNA-protein interaction for the users who need to get acquainted with the problem. ... NPIDB . ...

Еще в разделе: (Показать все результаты (>1356) - monkey.belozersky.msu.ru/ )

• PDB entries containing domains of the family "Reverse transcriptase
• PDB entries containing domains of the family "Reverse transcriptase connection
• PDB entries containing domains of the family "Reverse transcriptase thumb

... Problems building
<tt> mpich
</tt> . Up: Problems Next: General Previous: LINUX . ... Up: Problems building
 mpich
 Next: Workstation Networks Previous: Problems building
 mpich
 . ... Up: Problems building
 mpich
 Next: Cray T3D Previous: General . ... Up: Problems building
 mpich
 Next: Intel i860 Previous: Workstation Networks . ... Up: Problems building
 mpich
 Next: Problems in testing Previous: IBM SP2 . ... Центры . ...

Еще в разделе: (Показать все результаты (>731) - www.parallel.ru/ )

• FFTW - Table of Contents | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Get_version | PARALLEL.RU - Информационно-аналитический центр по
• Installation Guide to mpich,a Portable Implementation of MPI | PARALLEL.RU -

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>121) - www.spm.genebee.msu.ru/ )

• Scanning Probe Microscopy Image Processing Software User's Manual FemtoScan

... News . ... The major part of the course is dedicated to the studying measuring devices and units for data collection and processing, re-engineering of unknown circuits. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ... Working on a course project: testing of a board or a device with unknown malfunctioning, faultfinding and debugging, demonstration of the functioning device. ... 2013-2015 Engineering Physics Laboratory...

Еще в разделе: (Показать все результаты (>81) - engineering.phys.msu.ru/ )

• Parallel Programming
• Introduction to Linux

... HUMLANG . ANNOUNCEMENTS . 20.12.2002 Book announcement . ... Reference Direct and Anaphoric . Alan Berger . In this book Alan Berger further develops the new theory of reference--as formulated by Kripke and Putnam--applying it in novel ways to many philosophical problems concerning reference and existence. ... The book is organized in three parts. ... Electronic Dictionary . New electronic dictionary "Religious Lexicon in Russian Poetry of Silver Age" (A-G) (add by V.P.Grigoriev) . ...

Еще в разделе: (Показать все результаты (>78) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• HumLang Russian version
• Human Language - Язык Человека

... Educational materials . ... Here you can find and download some educational materials.See russian version for more details. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>133) - new.math.msu.su/ )

• Graduate study | Department: General Problems of Control. Faculty of Mechanics
• History | Department: General Problems of Control. Faculty of Mechanics and
• Choose language | Department: General Problems of Control. Faculty of Mechanics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The biofouling problems in reverse osmosis and ultrafiltration elements are considered. ... Based on obtained data the prognosis for point-of-use reverse osmosis element applied on tap water was done. ... Keywords: reverse osmosis, ultrafiltration, biofouling, biofilm, prediction of product flow decrease, removal of foulants. ... Flemming H.-C. Reverse Osmosis Membrane Biofouling. ... Flemming H. C., Schaule G., Investigation on biofouling of reverse osmosis and ultrafiltration membranes. ...

Еще в разделе: (Показать все результаты (>808) - chem.msu.ru/ )

• INTERNET-PORTAL "CHEMNET"аа
• Moscow University Chemistry Bulletin Vol. 47, No. 2, P. 134 (2006)
• Entrance Examinations - Preliminary Round