... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Не могу перекрыть базовый метод [Delphi] . ... Re: Не могу перекрыть базовый метод [Delphi] [ re: Ighn ] . ... Re: Не могу перекрыть базовый метод [Delphi] [ re: Yorik ] . ...
... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Не могу перекрыть базовый метод [Delphi] . ... Re: Не могу перекрыть базовый метод [Delphi] [ re: Ighn ] . ... Re: Не могу перекрыть базовый метод [Delphi] [ re: Yorik ] . ...
... О UNИX . ... ACL processing . ... read - users will be able to read a page, and download its attachments. write - users will be able to edit (write) a page, and upload attachments. delete - users will be able to delete a page and it's attachments. revert - users will be able to 'revert' a page back to an older revision. admin - users will be able to change the "#acl" line on a page, as well as grant and/or revoke "admin" privileges from others. ... ACL used if no ACL is specified on the page . ...
... О UNИX . ... ACL processing . ... read - users will be able to read a page, and download its attachments. write - users will be able to edit (write) a page, and upload attachments. delete - users will be able to delete a page and it's attachments. revert - users will be able to 'revert' a page back to an older revision. admin - users will be able to change the "#acl" line on a page, as well as grant and/or revoke "admin" privileges from others. ... ACL used if no ACL is specified on the page . ...
... Apache HTTP Server Version 2.0 . ... A single control process launches the number of child processes indicated by the NumServers directive at server startup. ... For each child process, Apache assesses the number of idle threads and creates or destroys threads to keep this number within the boundaries specified by MinSpareThreads and MaxSpareThreads . ... The User and Group directives are used to set the privileges of the Apache child processes. ... Maximum number of threads per child process . ...
Fortran DVM - contents . Part 1 (1-4) . ... task . ... CDVM $ PROCESSORS P(NUMBER_OF_PROCESSORS( )) C arrays A1,A2,A3 - the function values on the previous iteration C arrays B1,B2,B3 - the ... current iteration REAL A1(M,N1+1), B1(M,N1+1) REAL A2(M1+1,N2+1), B2(M1+1,N2+1) REAL A3(M2+1,N2+1), B3(M2+1,N2+1) C declaration of task array CDVM $ TASK MB( 3 ) C aligning arrays of each block CDVM $ ALIGN B1(I,J) WITH A1(I,J) CDVM $ ALIGN B2(I,J) WITH A2(I,J) CDVM $ ALIGN B3(I,J) WITH A3(I,J) C ...
Strong negative selection on CpG dinucleotides in the human gen ome: a compar ison of de novo and in herited mutation rates Serge y A. Spirin Department of Mathematical Methods in Biology, Belozersky Institute, Moscow State ... Information Transmission Problems, Russian Academy of Sciences , ypanchin@yahoo.com In a recent article Kong et al.1 meas ured de novo mutatio ns rates in 78 huma n parent-offspring trios ...
[
Текст
]
Ссылки http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/193.pdf -- 12.8 Кб -- 03.06.2013 Похожие документы
Электронная библиотека Попечительского совета . ... Simo J.C. - Algorithms for static and dynamic multiplicative . ... Название: Algorithms for static and dynamic multiplicative . ... A formulation and algorithmic treatment of static and dynamic plasticity at finite strains based on the multiplicative decomposition is presented which inherits all the features of the classical models of infinitesimal plasticity. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...
... What distinguishes Armenian from most other Indo-European languages is the unusually high proportion of early lexical borrowings. ... The first case is that of Urartean, a non-Indo-European language spoken during the first millennium BC in the mountains of Eastern Anatolia, roughly in the same area where Armenians lived up to 1915. ... The second one is the case of Parthian, an Indo-European Iranian language that was spoken in Northern Iran from around 300 BC to 300 AD. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Armenian1.pdf -- 124.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/Armenian1.pdf -- 124.0 Кб -- 30.04.2010 Похожие документы
... Sheet dike complex of the forearc ophiolite . ... Dike series serve the joining of a heterogenous ophiolite complexes . They are presented link packets and swarms of dikes and semidikes and locally single dikes of diabase and gabbro-diabase. ... The interrelations between the dike complex and the rest of the members of ophiolite association do not suggest significant horizontal movements of ophiolite before semidikes packets intrusion. ... Semidike rocks of the former . ...
... Credit: George C. Privon ( U. Virginia ) Explanation: What created those rocket waves, and why did they destroy that sun dog? Close inspection of the above image shows not only a rocket rising near the center, but unusual air ripples around it and a colorful sundog to the far right. ... The air ripples -- seen about one minute after launch -- were unexpected, as was the sudden disappearance of the sundog after the ripples passed. ... Publications with keywords: rocket - launch - Sun dogs . ...
This module provides for determining the types of files from the filename and for association of handlers with files. ... The directives AddCharset , AddEncoding , AddHandler , AddLanguage and AddType are all used to map file extensions onto the meta-information for that file. ... Files> . ... For example, if you had a directory you wanted to be parsed entirely as imagemap rule files, regardless of extension, you might put the following into an .htaccess file in that directory: SetHandler imap-file . ...
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
Sign Systems Studies 30 (1), 2002, pp. ... Any living system possesses internal embedded description and exists as a superposition of different potential realisations, which are reduced in interaction with the environment. ... We will show later that the internal evolutionary process can be modelled as a function of the system's state at time past, present and future with fundamental consequences for biological perfection. ... Time, reflectivity and information processing in living systems. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/igamberdiev-SignSystemStudies2002.pdf -- 57.7 Кб -- 28.02.2014
[
Текст
]
Ссылки http://www.chronos.msu.ru/old/EREPORTS/igamberdiev-SignSystemStudies2002.pdf -- 57.7 Кб -- 14.12.2013
[
Текст
]
Ссылки http://chronos.msu.ru/old/EREPORTS/igamberdiev-SignSystemStudies2002.pdf -- 57.7 Кб -- 14.12.2013 Похожие документы
... Okhapina, E. Y. The Boundary Zones of the Eastern Urals . Natural restrictions of the East Uralian structures are two intensive deformed boundary zones, which are the Sheludivy Gory Boundary Zone (SGBZ) in the west and the Redutovo Boundary Zone (RBZ) in the east. SGBZ represents a package lens-shaped and steeply dipping faulted blocks, horizontal dimension of which usually does not exceed 2 km. ... Deformation degree in this boundary zone are significantly higher than in the former. ...
... Geography of World Economy . ... This led to the need to study the spatial organization of the world economy, geopolitics, the geography of international economic relations, regional integration of states and other relevant topics. ... Elena N. Samburova, PhD (Geography): geographical Sinology; the geography of international economic relations; position of Russia in the world economy; . ... Introduction into the Geography of World Economy: International Division of Labor (in Russian) . ...
... История медицинского образования в МГУ . ... ;legends of cardiology and leading cardiologists on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of...
Study of single top quark production with the CMS detector Natalia Tsirova D.V. Skobeltsyn Institute of Nuclear Physics, Moscow State University for the CMS collaboration QFTHEP 2013 25 June Outline Single top processes and motivation t-channel measurements Cross section Charge asymmetry Associated tW production Summary 2 Single top Single top quark analysis) t-channel cross section (7 TeV) | analysis: likelihood fit to | ...
[
Текст
]
Ссылки http://qfthep.sinp.msu.ru/talks2013/tsirova_qfthep_2013-06-25.pdf -- 1180.3 Кб -- 25.06.2013 Похожие документы
... 1, 64295 Darmstadt, Germany, 004906159712545, s.sommer@gsi.de Multicolor in situ hybridization (m-FISH) and Spectral Karyotyping (SKY) are molecular cytogenetic techniques that permit the simultaneous visualization of all human (or mouse) chromosomes in different colours (chromosome painting), facilitating a detailed karyotype analysis. ... In the present talk new insights into the induction of aberrations by high + low LET radiation, analysed by m-FISH will be discussed. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы