Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... немецкий химик, член Берлинской Академии наук . Цирконий (лат. ... Известно пять природных изотопов циркония: 90 Zr (51,46%), 91 Zr (11,23%), 92 Zr (17,11%) 94 Zr (17,4%), 96 Zr (2,8%). В 1789 году немецкий химик М. Г. Клапрот в результате анализа минерала циркона выделил двуокись циркония Порошкообразный цирконий впервые был получен в 1824 году И. Берцелиусом, а пластичный - в 1925 году нидерландскими учеными А. ван Аркелом и И. де Буром при термической диссоциации иодидов циркония. ...
... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...
... Rapid developments of lasers and particle accelerators resulted in implementation of laser plasma X-ray sources and free electron lasers for various experiments requiring high intensity, shrt duration and monochromatic X-ray radiation. ... BASICS AND APPROACH Thirty years development of laboratory X-ray lasers allowed to reach ~0.1 keV photon energy of coherent X-ray beams in a repetitive mode. ... X-rays originate from Thomson scattering of counter propagating laser and electron beams. ...
Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...
... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf -- 115.3 Кб -- 19.03.2008 Похожие документы
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
The Ecological Cooperation Project is the first large-scale children's network project in Russia. This project was founded on the principles of development and achievement of widespread nature awareness among Russian school children through the establishment and unification of numerous childrenтАЩs ecological projects. ... Nature Protected Areas . ... The Project is open for cooperative learning, and any childrenтАЩs ecological organization or group is welcome to participate. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы