... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/Bologne.doc

... Synchronous Evolution of Galaxies in Groups: NGC 524 Group O. K. Sil'chenko and V. L. Afanasiev 245 ISSN 1990-3413, Astrophysical Bulletin, 2012, Vol. ... Four of the five galaxies revealed synchronized bursts of star formation in the nuclei 1­2 Gyr ago. The only galaxy, in which the ages of stellar population in the nucleus and in the bulge coincide (i.e. the nuclear burst of star formation did not take place) is NGC 502, the farthest from the center of the group of all the galaxies studied. ...

Еще в разделе: (Показать все результаты (>47) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ic3653.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Faculty in the people . ... The faculty educational programs (? ... Art business ?) give students an opportunity to get fundamental specialized training and become highly qualified specialists in the sphere of administration in sport and culture. ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...

Еще в разделе: (Показать все результаты (>5) - hsscm.msu.ru/ )

• Management in Culture - Magistracy - Higher School of Policy in Culture and
• Management in Sport - Magistracy - Higher School of Policy in Culture and
• Magistracy - Higher School of Policy in Culture and Administration in

... Newsgroups: sci.astro,sci.space.tech,sci.space.science,sci.space.shuttle,sci.answers,news.answers . Subject: Astro/Space Frequently Seen Acronyms . ... Acronym List for Space and Astronomy . ... Note that this is intended to be a reference for frequently seen acronyms, and is most emphatically not encyclopedic. ... Anglo-Australian Observatory . ... Astronomical Image Processing System . ... American National Standards Institute . ... Data Relay Satellite . ... List of Frequently Seen Acronyms (!) ...

Еще в разделе: (Показать все результаты (>209) - www.kosmofizika.ru/ )

• CRRES 560
• Background: Coordinate systems and transformations
• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE

... 2002. ... 110 MT2 MT8, 9 MT8 MT2 MT8 111 373 374 MT8 MT2 375 376 MT8 MT8 MT8 MT7 377 3 MT2 378 379 MT8 MT1 MT8 MT7 380 MT5 MT2 381 382 MT2, 5, 6, 7 MT2 383 . ... MT1, 8 112 MT7 MT8 MT4 MT8 MT2 MT7 MT8 MT2, 5, 6, 7 MT2 MT1 8 MT2 MT8 MT2, 8 MT8 MT8 113 MT8 MT8 MT7, 8 MT8 MT4 MT8 MT2 MT1, 2, 4, 7, 8, 9 MT8 MT1-9 395 Gunter C. Semantics of Programming Languages. ... 116 MT9 MT8 117 « » MT8 MT3 MT5, 9 MT8 MT2 MT7 P1, IT8 P1 P1, IT8 IT1, IT8 P1 MT2, 8 P7, IT1 P3, IT1 445 Tucker A. Applied Combinatorics. ...

Еще в разделе: (Показать все результаты (>4) - math.chem.msu.ru/ )

• BK_Assignments - Новый элемент
• BK_Assignments -

... 000, 1­12 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...

Еще в разделе: (Показать все результаты (>4) - kcor.sai.msu.ru/ )

Sun Microsystems «-» ! Sun Microsystems, « » AMD , . ... Sun , , , ». ... T Fire « » Sun Fire X2100 Sun Microsystems. Sun Fire X2100 64 AMD OpteronTM. -- http://hpc pro.parallel.ru. 26 1 2006 . http://hpc pro.parallel.ru. http://www.parallel.ru, http://ru.sun.com, http://www.t platforms.ru, http://hpc pro.parallel.ru, http://www.amd.com/ru ru. ... Sun Fire X2100: http://ru.sun.com/products/servers/entry/fireX2100/index.html « -- » http://hpc pro.parallel.ru. , , hpc pro@parallel.ru. . ...

329. Источники информации по тематике ПЛИС

330. http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc

331. Radchenko, Eugene V. - Laboratory of Medicinal Chemistry

332. http://www.fbb.msu.ru/res/DOC202/stud_konf_2013.doc