Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...
... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
... Зорич Владимир Антонович . ... Профессор кафедры Математического анализа механико-математического факультета МГУ. ... Автор 85 математических работ (2012) и университетского учебника по математическому анализу для студентов физико-математических специальностей. ... Зорич В. А., Математический анализ задач естествознания , МЦНМО, М., 2008 . ... В.А.Зорич, Математический анализ задач естествознания. ... В.А.Зорич, Математический анализ (в двух томах: части I и II). ... В.А.Зорич, Математический анализ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
... We thank the Swift team for their rapid scheduling of this observation. ... 2455705.20851 V 14.15 0.03 2455707.83079 V 14.10 0.03 2455710.84028 V 13.53 0.02 2455713.64631 V 13.66 0.02 2455714.65479 V 14.11 0.03 2455714.71823 V 14.12 0.02 2455714.78596 V 14.20 0.02 2455717.39593 V 14.37 0.03 2455726.62861 V 14.83 0.04 2455727.16343 V 14.57 0.04 2455730.50586 V 14.57 0.03 2455730.57329 V 14.56 0.03 2455730.70360 V 14.66 0.04 2455738.32865 V 14.00 0.02 2455742.86146 V 14.21 ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
ЛАБОРАТОРИЯ . ... The events surrounding the transfer of power from the legitimate heir and subsequently Emperor Peter III to his wife Catherine as a result of the coup d’Иtat of June, 1762, bring out some of the most interesting ways in which odes could move beyond the panegyric mode into themore dangerous territory of political commentary. ... The problem was particularly acute for those poets who, unwisely, had rushed to write odes in praise of Peter III when he came to power. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Institute of Mechanics . ... In 1977- 1991 A .P.Seyranian was a Member of Scientific Staff at the Institute of Problems in Mechanics of the Academy of Sciences in Moscow . ... Since 1993 A .P.Seyranian is a Leading Researcher and Professor of the Institute of Mechanics , Moscow State Lomonosov University . ... In 2003 he became an Invited Speaker and Chairman of the Session 'Stability and Control Problems in Mechanics' at the conference 'Physics and Control 2003' , Sankt-Petersburg. ...
Профсоюзная организация НИИ механики МГУ . ... Добавил(а) Администратор . ... Летать ? ... I место Sport class Dutch Open 2013 (Франция), . ... Sport class 2015 (Франция), . ... Sport class 2015 (Испания). ... Дирекция и Профком НИИ механики МГУ поздравляют всех сотрудников института с Наступившим 2016 Новым Годом! ... 26 ноября 2015 г.љв 15:00 в кинозале пройдет отчетно-выборная профсоюзная конференция НИИ Механики МГУ. ... 22 октября 2015 г. в НИИ механики МГУ состоится концерт . ...
Environmental summer camp in Estonia 3-11 August . ... camp and a case study "The potentials and limits of sustainable development . in Otepфф Nature Park, Estonia". ... Costs: All costs in Estonia will be covered (accommodation, food, local . ... your own bike with you. ... natural values of the landscape of Otepфф municipality in Estonia. ... part of Estonia in a peripheral area. ... The nature surrounding Otepфф is a . ... small area local government, private economic enterprises and Otepфф . ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...
[
Текст
]
Ссылки http://www.geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016 Похожие документы
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...
... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_an-example.pdf -- 690.9 Кб -- 27.02.2014 Похожие документы