... Вт Фев 10 15:18:12 MSK 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/02/2009] . ... Выпуск 259 . 10 февраля 2009 г. ------------- ЧТО НОВОГО? http :// parallel.ru /about/whatsnew.html + Выложена страница Основная схема быстрого преобразования Фурье . http ://fpga.parallel.ru/fft + В разделе, посвященном компьютерам с реконфигурируемой архитектурой на основе ПЛИС выложены новые статьи на странице Публикации по проекту . http ://fpga.parallel.ru/ ...
... О факультете . ... Coastal Ecology and Biological Safety . ... June 14 ? ... Nikolai Pertsov White Sea Biological Station , Northern Russia . ... Lomonosov Moscow State University . ... Food at the biological station: 125 ? ... transfer to Leningradski railway station ( Moscow ) . ... arrival to Poyakonda village; transfer to the biological station by boat. ... departure from biological station; transfer to Poyakonda by boat; local bus excursion (TBC) . ... Биологический факультет МГУ . ...
... Название шкалы в опроснике для клиента (1987 просмотра) . ... Psyling . Написано: 2009-08-13 18:15 . Столкнулся с тем, что в опроснике депрессии Бека на английском языке перед вопросами, которые даются клиенту, есть название шкалы: Sadness, Loss of energy (всего 21). В то же время, в одной из русских версий http://www.hr-portal.ru/node/8214 даются просто вопросы, типа Мне так грустно или печально, что я не могу этого вынести. ... Я к тому, что шкалы лучше не называть. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... 2012. ... 100%; 87 87% . ... 313 , , 8000, , . ... 313 8000 , 56 ; , : 46% (144 310 ) . ... 14 2008 . ... 03 336 « », « (Diplo ma Supplement) ». ... DEMC HU K A. THE DEV ELOPME NT OF ACA DEMIC A MOBILITY IN RUSSIAN HEIS AND THE NEW FSES The article contains statistical data, which reflects the modern state of academic mobility in HEIs in the Russian Federation (the data was gathered while monitoring the efficiency of implementation of federal state educational standards (FSES) by HEIs). ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/razv_akadem_mob_12_12.pdf -- 343.5 Кб -- 01.04.2013 Похожие документы
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
... Преподаватели физфака . ... Материалы . ... Автор: .. ... Лекции Бадьина вредительские, сам преподаватель привил мне лишь нелюбовь и отторжение к математике, с которым пришлось справляться самостоятельно впоследствии. ... Андрей Валентинович вел у нас семинары на 1 курсе и честно говоря первые пол семестра на этих самых семинарах я (как и большая часть группы) чувствовала себя полной дурой: с непривычки его манера изложения пугала и плохо воспринималась. ... Добавить мнение о преподавателе . ...
Электрожурнал . Как часто драгоценное время учебных занятий уходит на решение рутинных проблем, связанных с выяснением мелких организационных вопросов типа выдачи очередного задания студенту или выставления оценки за выполненную работу! ... Преподаватель в любое удобное для себя время имеет возможность оперативно просмотреть и проанализировать информацию о текущей успеваемости для любой учебной группы курса. ... Возможность варьирования индивидуальных учебных планов студентов. ... Проекты | ...
BIRD SPECIES DATABASE . of the Arctic Birds Breeding Conditions Survey . ... Queries . View list of species . ... Get list of species, for which data are available by pushing "Query" button below "View list of species" invitation. Latin name of a species can be copied from the list to the "Species name" field or typed-in there (but exactly as it appears in the species list). ... Query results will be tabulated in the window below the map, and can be browsed through or copied. ...
General Utility Lattice Program Version 4.0 Julian D. Gale Nanochemistry Research Institute, Department of Chemistry, Curtin University, P.O. Box U1987, Perth, WA 6845, Australia email: gulp@ivec.org 1 Chapter 1 Introduction & background The General Utility Lattice Program (GULP) is designed to perform a variety of tasks based on force field methods. The original code was written to facilitate the fitting of interatomic potentials to both energy surfaces and empirical data. However, it has expanded now to
МГУ имени М.В.Ломоносова Русская версия . ... Chairman : Kozlova Natalya V. - Deputy Dean of Law Faculty on study, Doctor in Law, Professor. ... Golichenkov Alexander K. (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) . ... Komissarov Vladimir S. (Head of the chair of criminal law and criminology of Law Faculty, Doctor in Law, Professor). ... Suchanov Evgenyi A. (Head of the chair of civil law of Law Faculty, Doctor in Law, Professor). ... Civil law . ...
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Network Working Group R. Fielding Request for Comments: 2068 UC Irvine Category: Standards Track J. Gettys J. Mogul DEC H. Frystyk T. Berners-Lee MIT/LCS January 1997 Hypertext Transfer Protocol -- HTTP/1.1 Status of this Memo This document specifies an Internet standards track protocol for the Internet community, and requests discussion and suggestions for improvements. Please refer to the current edition of the "Internet Official Protocol Standards" (STD 1) for the standardization state and status of this
... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... Simultaneous measurement of local heat transfer and pressure drag coefficients on a smooth surface and a surface with complex relief (dimples, projections, grooves etc.), flown over by subsonic air stream , with velocity range from 5 m/s to 120 m/s. Simultaneous measurement of local coefficients of heat transfer and pressure drag on smooth surface and ... Measurement of thermal protection efficiency with the use of porous cooling and gas curtains. ...