... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Your Marketing Strategy Canada Business Service Centres - CBSCs 1. ... List your service(s) or product(s) . ... Personal Selling o Evaluate Media, Vehicles (Strengths/Weaknesses) o Target Market Analysis o Cost Advertising o Which media best reaches your customers? o When should you advertise? o How much should you spend? o How often should you advertise? o What should you advertise? o Cost/Benefit analysis Sales Promotion o What type of sales promotion should you do? o What form should it take? ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/english/yourmarketingstrategy.doc -- 97.5 Кб -- 27.10.2005
[
Текст
]
Ссылки http://innovation.msu.ru/english/yourmarketingstrategy.doc -- 97.5 Кб -- 27.10.2005 Похожие документы
... Шестая международная научная конференция по проблемам безопасности и противодействия терроризму . Руководство Московского государственного университета имени М. В. Ломоносова приняло решение о проведении в МГУ 11 13 ноября 2010 года Шестой международной научной конференции по проблемам безопасности и противодействия терроризму. ... Семинар-круглый стол Обсуждение перечня приоритетных направлений и исследовательских проектов, предназначенных для реализации участниками МИКИБ . ...
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
... 2012. ... 100%; 87 87% . ... 313 , , 8000, , . ... 313 8000 , 56 ; , : 46% (144 310 ) . ... 14 2008 . ... 03 336 « », « (Diplo ma Supplement) ». ... DEMC HU K A. THE DEV ELOPME NT OF ACA DEMIC A MOBILITY IN RUSSIAN HEIS AND THE NEW FSES The article contains statistical data, which reflects the modern state of academic mobility in HEIs in the Russian Federation (the data was gathered while monitoring the efficiency of implementation of federal state educational standards (FSES) by HEIs). ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/razv_akadem_mob_12_12.pdf -- 343.5 Кб -- 01.04.2013 Похожие документы
... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...
... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
exhibition (16.03?25.04.05) | dates of life | ... exhibitions | ... gallery | ... russian . ... Metro "Kitay-gorod", Polytechnical Museum, entrance 2 . The works of Lidija Timoshenko are widely known to the specialists studying the Russian art of both pre- and post-WWII art. ... Most sheets from this series are being displayed in this exhibition, while the rest are kept in the Russian Museum, State Pushkin museum, Tretyakov Gallery, and other Russian museums. ...
... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Администрация Химического факультета МГУ . ... Научный отдел Химического факультета МГУ создан в 1963г.. Деканом Химического факультета в те годы был профессор И.Ф. Луценко, а его заместителем по научной работе - профессор Ю.В.Филиппов. Курировали работу научного отдела со дня его основания заместители декана по научной работе - выдающиеся ученые факультета: В.М. Татевский, И.Ф. Луценко, Ю.В. Филиппов, Ю.Я. Кузяков, М.Я. Мельников, Б.А. Поповкин, О.А. Петрий, А.В. Анисимов. ... Отдел кадров . ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow University Press, 1994. ... W. Stevens. тАУ History of American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...