... Data . ... All links ] [ Models ] [ Space weather ] [ Research Institutions ] [ Data sources ] [ News sites ] [ Satellites ] [ Local library ] [ Education ] [ Journals ] [ Events ] . ... NSSDC Space Physics Models . ... Solar Influences Data analysis Center (Royal Observatory of Belgium) . ... Space Weather News Data Base . ... Space Weather Resources (NSSDC) . ... AAS Solar Planetary Division (AAS SPD) . ... Russian Space Science Internet . ... National Space Science Data Center (NSSDC) . ...
... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...
... Практически единственной возможностью устранения катаракты является операция по извлечению помутневшего хрусталика и введению интраокулярной линзы (ИОЛ) для восстановления фокусировки видимого излучения на сетчатку [1] . На сегодняшний день существует множество видов ИОЛ, отличающихся по форме, размерам, материалу, из которого они изготовлены, а также весом, цветом, способами фиксации на глазу и пр. [2] . ... модель ИОЛ . ... БЕЛОФТООПТИКА модель D . ...
... Физический факультет МГУ, 1959 г. Кандидат физико-математических наук, 1965 г. Доктор физико-математических наук, 1989 г. Профессор, 1994 г. Научные интересы: . ... Malvina Guseva, Vladimir Babaev, and Valery Khvostov, 'Carbyne a linear chainlike carbon allotrope', Chemistry and Physics of Carbon, A series of Advances, edited by Peter A. Thrower, 1997, v.25, p.1-69 . ... Подготовила 19 кандидатов наук ...
Research on gas dynamic temperature stratification. Leontev's tube. Photo of experimental model for research on gas dynamic temperature stratification. ... Research on the performance of Leontev's tube operating on natural gas carried out in Saratov. ... Functional diagram of the unit for gas dynamic temperature stratification (Leontev's tube). Experimental model for the research of gas dynamic temperature stratification efficiency . ...
... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... Chemically Decoupled Nuclei in Five Lenticular Galaxies from SAURON Data O. K. Sil'chenko* Sternberg Astronomical Institute, Universitetski i pr. ... We have now analyzed and published the SAURON data for five galaxies, including the above NGC 3384 and NGC 3623, in which the chemically decoupled nuclei are rather extended (several hundred parsecs) circumnuclear stellar disks. ... 1996 SAURON, Oct. ... In NGC 7280, we found an inner polar ring previously using MPFS data (Afanasiev and Sil'chenko 2000...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...
... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...
... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...
... Link] 04.02.05 01:19:30 boss : . ... Link] 03.02.05 13:04:35 Admin : . ... Link] 31.01.05 22:32:49 ket : . ... У меня стоит MikTeX, все сделала, как вы сказали. ... На сколько я поняла, этот пакет (cyrcm1) позволяет как-то организовать перенос слов в русском языке и на компе, с которого я информацию брала, он когда-был, т.к. в файле dvi, который судя по всему был тогда еще создан, переносы в словах есть. ... usepackage{amssymb,amscd,amsmath} . ... Link] 27.01.05 20:02:58 Yurich : . ... 2016, DMVN . ...
About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...
THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...