Меню . Главная Поиск О проекте Форум Control Panel Алгебра Математический анализ Действительный анализ Комплексный анализ Функциональный анализ Геометрия/Топология Логика/Дискра Механика ОДУ/УрЧП Оптимальное управление ТеорВер/МатСтат Теория чисел Физика ЧМ/Программирование Курсы ЕНС Нематематика TeX/MetaPost Книги Ссылки Wanted . ... Link] 25.06.07 14:07:36 Admin : Выпускной альбом/диск/etc. Информация для уже-почти-не-студентов 5 курса. ... Вам, ребята, троекратное ура: УРА! ... 2016, DMVN . ...
... Изображения. ... IMAGE: READ/IMAGE, WRITE/IMAGE, COMPUTE/IMAGE, COPY/II .. ... версии 98NOV с кратким описанием того, что данная команда выполняет. asload назначение дисплейного окна и визуализация в нем изображения ; areatable построение таблицы, содержащей определение областей заданного разме- ра, равномерно покрывающих заданное изображение; 95 autocuts определение хороших уровней для визуализации изображения ; buildcube построение куба данных из заданного набора двумерных ...
Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Новости . ... Главная Новости Профком . В этот четверг 15 ноября в 19.00 в аудитории 5-19 (ФизФак) . ... Смотрим фильм " Завтрак у Тиффани " . ... 2 премии "Оскар" - за лучшего композитора и лучшую песню, 3 номинации - за лучшую актрису, лучший сценарий, лучших художников. Премия "Грэмми" за лучший саундтрек к фильму, премия "Golden Laurel" - лучшая песня, премия Гильдии писателей Америки - лучший комедийный сценарий. ... 2002-2012 Студенческий сайт Физического факультета МГУ Контакты . ...
... TELLING AMERICA'S STORY: NARRATIVE FORM AND THE REAGAN PRESIDENCY WILLIA M E LEWI S By 1980 , Americ a ha d los t its sense of direction . ... The n Ronal d Reaga n cam e ont o th e scene wit h a visio n of America that reinvigorate d th e nation . ... NARRATIV E FOR M I N REAGAN' S RHETORI C Reaga n tells tw o kind s of stories tha t differ in scale an d purpose , but that wor k togethe r to establish th e dominanc e of narrativ e form in th e creation and in th e interpretatio n of his rhetoric . ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Lecturers . Faculty in the people . ... The leading representatives of Russian sport and culture are engaged in teaching at the faculty: . ... Mark A. Gurvich Chairman of Moscow Board of Theatres, . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... Юрий (admin) Новости заработать в интернете , опросы , платные опросы No Comments . ... Юрий (admin) Новости R , психометрика No Comments . ... Юрий (admin) Новости компетенции , оценка персонала No Comments . ... Юрий (admin) Новости IBM SPSS Statistics , SPSS , SPSS Evaluation Version , скачать SPSS No Comments . Скачать официальные ознакомительные (14 дней) версии IBM SPSS Statistics для Win32|64, Mac и Linux можно по этой ссылке , заполнив регистрационную информацию. ... Скачать SPSS . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Астрономические данные в Сети - где искать и как пользоваться? Сайты с астрономической библиографией . ... Солнечные сайты . ... Астероидные сайты . ... http://www.uic.rsu.ru/astro/ А наиболее полный список на сайты по теме " что почитать по астрономии " (по-русски) можно найти в соответствующем разделе рейтингового каталога АстроТоп-100 . ... Прекрасная система поиска позволит Вам найти обзорные статьи практически по любому разделу современной науки - от физики и астрономии до химии и биологии. ...
... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...
... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы