... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...
... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... История кафедры . ... S. Auclair, R. Uzbekov, S. Elis, L. Sanchez, I. Kireev, L. Lardic, R. Dalbies-Tran, and S. Uzbekova. ... I. Vorobjev, K. Buchholz, P. Prabhat, K. Ketman, E. Egan, M. Marti, M. Duraisingh, and N. Barteneva. ... Belmont AS, Hu Y, Sinclair PB, Wu W, Bian Q, Kireev I. Insights into Interphase Large-Scale Chromatin Structure from Analysis of Engineered Chromosome Regions. ... Цитология, (2010), т. 52, ? ... Hu Y., Kireev I., Plutz M., Ashourian N., Belmont AS. ... 2008), 5(4):311...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...
P.P. P . ... T : distS t; Ba ; M ; t; Ba ; t 0: T 6 , M M Ba : .R " S T; Ba : W " Ba | ... 1 kS0 T; u , S0 T; vk Lku , vk; kS0 T; u , S T; uk " 8u; v 2 Ba : T 0 ;"1 ;Ba , . ... 2 " Ba2 " B1 = S T; Ba2 S ;S0 "2 "+L"2 B1 1; 2. ... h 2Oi , distS n h; M i n; S k h 2Oi ; O i N. Oi zi O, 1 i n M i N, 3 0kn : jOi j S . distzi ; Oj jOi jL2 ; Oi , L V V S h i 6= j; N i O0 = On O i=0 0 n= Ln distS n h; M. : h 0 0 v V h V; \ n 2O; 4 0 qV h; q 1; 8h 2O : distS n0 +n h0 ; M max fjOj;Ln0 g n=N +1 6 T 10 . ...
Uneex . HyshnikProto2 . ... Также была затронута составляющая совместимости с иными ОС. ... yes . ... Run BSD code . ... Run Linux code . ... ALTQ - как я понял для shape'ing'a и вообще штука хорошая и удобная, чего нам еще надо от фильтра пакетов?? ... Ну и несомненный Хит Сезона, UFS2: Основные плюсы: а) возможность создания snapshot'ов ФС во время рботы системы, причем довольно шустро (150 гектар за 45 секунд...впечатляет) б) запуск fsck в бэкграунде, естественно очень удобно и нужно. ...
... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
1986. ... 1989?. ... 1988. ... 1992. ... Extraterrestrial cause for the Cretaceous-Tertiary extinction // Science. ... Vol.208, N 4448. ... Cretaceous-Tertiary event: Noble gases in Turkmenia K/T boundary sediments // Lunar. ... Elder W.P. Molluscan extinction patterns across the Cenomanian-Turonian stage boundary in the Western Interior of the United States// Paleobiology.1989.Vol.15. ... The Frasnian-Famennian extinction: current results and possible causes // Devonian of the . ... 1988.Vol. ...
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...
... Лауреат Государственной Премии Российской Федерации 1996 года (в области математики) за цикл работ по теории инвариантов многообразий и гамильтоновых динамических систем. Автор 180 научных работ, 26 математических монографий и учебников, специалист в области геометрии и топологии, вариационного исчисления, теории минимальных поверхностей, симплектической топологии, гамильтоновой геометрии и механики, компьютерной геометрии. ... В этом смысле многие графические работы имеют утилитарный характер. ...
... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...
Create user account [Комиссия по практикуму, 3 семестр, 2015-2016] . login: . e-mail: . ... Use an existing account . To create an account, please think out, a login and provide your valid e-mail address in the form above. Then press the \"Create account\" button. Login may contain only latin letters, digits, . ... Use this password for the first log in. ... If you already have an ejudge account on this server, you may use it. If so, follow the link: Use an existing account . ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... СНО . ... Хирургическая секция . ... В разделе " Лекции и доклады " добавлены презентации. 27.09.2011 в 18:30 по московскому времени состоится первое заседание хирургической секции в новом учебном году. 18.05.2011 состоится очередное заседание хирургической секции. ... 27.04.2011 состоится очередное заседание хирургической секции. ... 1.12.2010 состоится очередное заседание хирургической секции . ... Факультет фундаментальной медицины Московского государственного университета им. М.В. Ломоносова . ...