... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... В рамках инновационной образовательной программы "Формирование системы инновационного образования в МГУ имени М.В.Ломоносова" была поставлена цель: создать единую среду дистанционного обучения, которая позволит открыть весь спектр университетского знания через электронные библиотеки, учебники и курсы, аудио- и видеоматериалы. Одной из приоритетных задач проекта является создание Центрального узла Системы дистанционного обучения и разработка информационной среды дистанционного обучения (ИСДО) МГУ. ...
... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...
available at SciVerse ScienceDirect Journal of Alloys and Compounds journal h omepag e: www.elsevier.c om/locate/jalcom Study of adsorption properties of functionalized nanodiamonds in aqueous solutions of metal salts using optical spectroscopy T.A. Dolenko a,, S.A. Burikov a, K.A. Laptinskiy a, T.V. Laptinskaya a, J.M. Rosenholm ... Hypothetic mechanism of nitrate and copper ions adsorption on NDs surface is proposed. с 2013 Elsevier B.V. All rights reserved. ...
Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...
[
Текст
]
Ссылки http://www.mse-msu.ru/Ayvazyan_Introduction_to_the_textbook_on_econometrics.pdf -- 67.4 Кб -- 12.10.2011 Похожие документы
... In Chap. ... sign cos : By the theorem on the motion of the center of masses in the space in projections to the related axes .x ; y ; z/ and the theorem on the change of the kinematic moment with respect to these axes, we obtain the following complete system of differential equations in the dynamical quasi-velocity space R1 fvg S2 f; g C R3 fx ;y ;z g: v cos P v sin C y v sin sin P 2 2 z v sin cos C .y C z / D Fx =m; v sin cos C v cos ... I2 n0 d cos with variable coefficient....
... В данном разделе приводятся и кратко описываются основные источники информации по тематике компьютеров на базе ПЛИС. FPGA-FAQ . ... http://www.fpga4fun.com/ . ... http://en.wikipedia.org/wiki/FPGA . http://ru.wikipedia.org/wiki/%D0%9F%D0%9B%D0%98%D0%A1 . ... http://www.tutorial-reports.com/computer-science/fpga?PHPSESSID=b0807160c969a1706c5477d257c18f97 . http://www.gaw.ru/html.cgi/txt/ic/Xilinx/plis/plis_fpga.htm . http://www.fpga.ru/ . ... http://www.osp.ru/cw/1997/36/23812/ . ...
... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc -- 21.5 Кб -- 14.06.2015 Похожие документы
... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/febsz.pdf -- 49.2 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/febs1998.pdf -- 49.2 Кб -- 18.02.2008 Похожие документы
... Soc. 376, 10331046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...