... 2013 тАФ Academic Writing: Russian and International Experience (Moscow) . ... 2009 тАФ Media Imagination (Moscow) . 2008 тАФ University Among the Media: Innovation in Higher Learning and Changing Modes of Effective Communication (Moscow) . ... 2003 тАФ Reading Everyday Life in American and in Russian: Semiotics of Culture and Intercultural Communication (Yasnaya Polyana) . 2002 тАФ Popular Literature: American and Russian Experience in Cultural Myth-Making (Moscow) . ... Summer School 2016 . ...
... Международный Университет . Междисциплинарных Знаний . ... Главная . Кафедры . ... Заведующий кафедрой - Урманцев Юнир Абдуллович, доктор биологических наук, доктор философских наук, профессор, автор многих монографий, руководитель семинаров в области общей теории систем, эволюционики, симметрологии и т.д. Кафедра системологии. ... Университет состоит из кафедр. ... Заведующий кафедрой - Куликов Алексей Михайлович, автор многих работ в области теории эволюции, генетики, эволюционной генетики. ...
WERE HITTITE KINGS DIVINELY ANOINTED? ... This is the only clear evidence that the gods were thought to be personally responsible for the anointment of Hittite kings. ... I am arguing that anointment with oil was extended to both Hittite priestly kings and certain other categories of Hittite priests, and that the underlying purpose of this act was ritual cleansing. ... Its beginning is preserved in two mutually complementing parallel versions KUB 35.165 Obv. ... the priest, son of the king'. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf -- 199.5 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf -- 199.5 Кб -- 30.04.2010 Похожие документы
Cell Biology International 27 (2003) 293294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf -- 67.3 Кб -- 04.03.2004 Похожие документы
... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... Soc. 376, 10331046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Neutrino-helium ionizing collisions: Electromagnetic contribution Konstantin A. Kouzakov1;2, Yulia A. Rodina1, and Alexander I. Studenikin 1. Department of Nuclear Physics & Quantum Theory of Collisions, Faculty of Physics, Lomonosov Moscow State University, Moscow 119991, Russia 2. ... The Feynman diagram illustrating how the electron neutrino can interact with an external electromagnetic field. ... High Energy Phys. 2012, 459526 (2012) [2] A. G. Beda et al., ... Phys. At. ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...
Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
Психология имеет долгое прошлое, но довольно короткую историю" (Г. Эббингауз, 1908) . Статьи и ссылки по истории психологии. Конференции 2000 года. ... Millennium World Conference in Critical Psychology, Sidney, Australia . XXVII Congress of Psychology 2000, Stockholm, Sweden . ... CSS 2000, the annual online conference for the Association for Computers and the Social Sciences . ... CiP2000, Computers in Psychology Conference , 29th March - 31st March 2000, University of York, UK. ...