A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...
Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf -- 97.8 Кб -- 16.03.2009 Похожие документы
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...
... Monshausen G*, Bibikova TN*, Shi C, Weisenseel M, Gilroy S (2007) Oscillations in extracellular pH and reactive oxygen species modulate tip growth of Arabidopsis root hairs. ... Vincent P, Chua M, Nogue F, Fairbrother A, Mekeel H, Xu Y, Allen N, Bibikova TN, Gilroy S, Bankaitis VA (2005) A Sec14p-nodulin domain phosphatidylinositol transfer protein polarizes membrane growth of Arabidopsis thaliana root hairs. ... Bibikova TN, Gilroy S (2008) Role of calcium in root hair growth and development. ...
Московский Государственный Университет им. М.В.Ломоносова Факультет Вычислительной Математики и Кибернетики Кафедра АСВК ДИПЛОМНАЯ РАБОТА НА ТЕМУ: "Исследование подходов к построению Интернет-музеев. ... 20 Статические сайты 20 Динамические сайты 21 Серверные технологии программирования 22 CGI 23 ASP 24 JSP и сервлеты 26 PHP 27 ColdFusion 28 SSI 29 Сравнение различных серверных технологий программирования динамических сайтов 30 Общая организация: Фреймы. ... LastName |VARCHAR(50) | ...
. Название публикации . A Summary of Activities of the US/Soviet-Russian joint working group on space biology and medicine . Авторы . C.R. Doarn, A.E. Nicogossian, A. Grigoriev, G. Tverskaya, E. Ilyine, O. Orlov . Дата . 31.12.2009 23:00:00 . Название журнала . Acta Astronautica. Том . Vol.67. первая страница . 649 . последняя страница . 658. Купить нет на складе . 2009 ФФМ МГУ, 2009
... INTERNATIONAL SYMPOSIUM ON SPIN WAVES . ... Scope of the Symposium . ... oral contributed papers (15 min.), . ... Abstracts of lectures and all papers, oral and poster, will be posted up on a stand during the whole day of the corresponding session. ... Two copies of abstracts of all papers are to be handed at the registration. ... The program of the Symposium will be handed to the participants at the registration. ... buses 13 and 39 or fixed-route taxi up to the metro station "Moskovskaja", . ...
Вернуться к оглавлению . Вернуться к предыдущей главе . Перейти к следующей главе . ГЛАВА 1. ОБЩИЕ СВЕДЕНИЯ О СЕТИ ИНТЕРНЕТ . ... Однако после создания программ-броузеров www-система начала очень быстро развиваться и сейчас практически определяет лицо сети Интернет. ... Если данная связь будет задействована, то программа-броузер автоматически установит по сети Интернет соединение с указанным сервером и выведет на экран монитора нужную часть документа. ...
... МГУ . ... Устав Студенческого комитета ИСАА МГУ был подписан 28 октября 2008 года, что и считается официальной датой основания организации, но история Студкома начинается еще в сентябре 2007 года, когда группа инициативных студентов собралась вместе, чтобы обсудить имеющиеся проблемы, с которыми сталкиваются проживающие в общежитии учащиеся ИСАА МГУ и реализовала самый первый проект "списки на заселение по комнатам с учетом пожеланий студентов" ( ранее списки составлялись по принципу свободных мест)...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...
... Подготовительные курсы для поступающих . Курсы иностранных языков . ... Курсы английского языка . Курсы китайского языка . Курсы японского языка . ... МГУ . ИСАА МГУ . 495) 971-3636 . ... Если Ваш ребенок определился и хочет поступать в гуманитарные вузы Москвы, то мы ему рекомендуем обучение на Подготовительных курсах Института стран Азии и Африки (ИСАА) Московского государственного университета имени М.В. Ломоносова в ?Центре подготовки к ЕГЭ? по гуманитарным дисциплинам. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... These approaches were: (1) laser photobleaching of a path through the centrosome; (2) direct observation of microtubules in centrosome-containing cytoplasts; (3) GFP-CLIP-170 expression as a marker for microtubule plus end growth; and (iv) sequential subtraction analysis. ... This result signifies that most MTs persistently grow from their time of birth at the centrosome until their plus end nears the cell margin. ... Growth of nascent MTs in CHO cells was not only persistent but rapid. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf -- 696.8 Кб -- 18.09.2002 Похожие документы
... Душа самосознающая / Сост. и вступ. ст. ... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Единство моих многоразличий:' Неотправленное письмо Сергею Соловьеву / Публ., вступ. ст. и коммент. ... Серебряный голубь: Рассказы / Сост., предисл., коммент. ... Сост. ... Бердяев Н. Письма Андрею Белому / Предисл., публ. и примеч. ... Робакидзе Г. Письма Андрею Белому / Публ. и предисл. ... Предисловие' А.Белого к неосуществленному изданию романа 'Котик Летаев' / Публ., вступ. ст. и коммент...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China
... CLEANSOIL . ... Therefore, the system is applicable to the remediation of soil below buildings, roads, pipelines, railroads, etc, for both local and/or diffuse contamination, and even for preventive applications. to develop and to test an innovative, simple, easy to handle, applicable under existing infrastructures and cost-effective on-site and in-situ soil remediation method able to achieve a degree of soil remediation that allows its reutilisation for different purposes; . ... http://soil.msu.ru ...