Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...

Еще в разделе: (Показать все результаты (>24) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part3.pdf
• http://www.eng.math.msu.su/download/Model_rendering.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ­ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ­ ( HA = r · HR + rw·Ha ). , r ­ ( UCM NOAH LSM « » , , , (, .) H = A H ­ , LSM +A HA , (, H ­ ; A , , ); A ­ , (, , ); HLSM ­ , NOAH LSM; HA ­ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>2) - atm563.phys.msu.ru/ )

... On-line консультант . ... Анонсы Online семинары . ... Семинар состоится 22.07.2010 в 16.00 . ... Семинар состоится 12.08 в 16.00 . ... Получить подробную информацию о семинарах и зарегистрироваться Вы можете на сайте . ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>5) - erp.cmc.msu.ru/ )

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Западная пивная компания приглашает на работу на должность System Network Administrator. ... Опыт работы от двух лет. ... Опыт работы с сетевым оборудованием Cisco. ... Западная пивная компания приглашает на работу на должность SAP Basis/DB2 Administrator. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ... Комментарии и предложения присылайте на адрес info@cmc online.ru . ...

Еще в разделе: (Показать все результаты (>7) - www.cmc-online.ru/ )

• ВМиК - Online! : Абитуриентам факультета ВМК МГУ - Варианты по английскому...

... ECOLOGY Present-Day State of Coral Reefs of Nha Trang Bay (Southern Vietnam) and Possible Reasons for the Disturbance of Habitats of Scleractinian Corals D. S. Pavlov1,3,4, A. V. Smurov2,3, L. V. Il'yash3, D. N. Matorin3, N. A. Kluyev1, S. V. Kotelevtsev3, V. S. Rumak4,1, and T. G Sampling of bottom sediments and biological objects, as well as photo and video shooting, were performed during scuba diving. ... The location of stations in Nha Trang Bay, 1990­2002. ... River sediment No. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3372.pdf
• http://library.biophys.msu.ru/matorin/3400.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>14) - www.fbm.msu.ru/ )

• Факультет фундаментальной медицины МГУ

... As the exper iment implied, the fir st type tur ned out much mor e appr opr iate, ther efor e consider its wor k in gr eat detail. е = - v б из ж д гд йв (1) is density of the entr opy pro- Self-consistent solution for the potential u in the liquid phase is (Kor otaev, 1979): cluding or contr ol ar e: temper atur e, electr ic and magnetic fields, illumination, moistur e, feed voltage unstability. wher e q is char ge of the main ion of the liquid phase ...

Еще в разделе: (Показать все результаты (>20) - temporology.bio.msu.ru/ )

• Лаборатория-кафедра "Природа времени и пространства в истории науки и...

... 4, No. 5 (2006) 1033­1056 c Imperial College Press RECOGNITION OF TRANSMEMBRANE SEGMENTS IN PROTEINS: REVIEW AND CONSISTENCY-BASED BENCHMARKING OF INTERNET SERVERS NATALIYA S. SADOVSKAYA Institute for Information Transmission Problems, Russian Academy of Science Bolshoi Karetny per. ... Landolt-Marticorena C, Williams KA, Deb er CM, Reithmeier RA, Non-random distribution of amino acids in the transmembrane segments of human typ e I single span membrane proteins, J Mol Biol 229(3):602­608, 1993. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/genome_biol_evol_2014.pdf

... E-mail: swan@mch.chem.msu.su (Received 0 XXXXXXX 0000; accepted 0 XXXXXXX 0000) The local environment of the Pb atom in Pbx Sn1 x S solid solution was studied by EXAFS technique. The shortest Pb­S bond length ° in orthorhombic samples was found to be by 0.2 A shorter than in cubic PbS. ... Strong correlations found in the distribution of metal atoms in the second shell show that the orthorhombic samples can be considered as solid solutions with unexpectedly strong short-range order. ...

Еще в разделе: (Показать все результаты (>71) - scon155.phys.msu.su/ )

• Photoelectric phenomena and metastable states in amorphous semiconductors
• Conduction in Granular Metals: Virtual State-Assisted Hopping
• Theory of electronic properties of disordered semiconductors and systems with

... Отмеченная наградами АстроТоп-а . ... Анатолий Анатольевич Волчков . ... кто-то из великих) Я долго подбирал название для этой мемориальной статьи об Анатолии Анатольевиче Волчкове. ... Какие только названия не приходили ко мне в голову - "Легенда об Анатолии", "Исполнить миссию", "Человеко-форум", "Камертон Астрорунета".. ... P.P.S. 31 декабря 2003 г. решением команды проекта Астротоп принято решение - "признать Анатолия Волчкова Человеком года " в традиционных конкурсах Звезды АстроРунета-2003 . ...

Еще в разделе: (Показать все результаты (>9) - www.astrotop.ru/ )

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>3) - newcryst.phys.msu.ru/ )

... О кафедре . ... Сотрудники . ... На кафедре работают 55 преподавателей и научных сотрудников, среди которых 13 профессоров и 19 доцентов, 17 сотрудников кафедры являются докторами и 36 - кандидатами наук. ... После окончания в 1985 году средней школы поступил на физический факультет МГУ. В 1994 году закончил аспирантуру кафедры математики физического факультета МГУ. С 1994 года сотрудник кафедры. ... A.V. Shchepetilov. ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>15) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

... 7. 6 , 216 . ... 1990. . ... http://www.philol.msu.ru .. http: www.ruthenia.ru/folklore/indexes.htm « : , , ». () http://www.ruthenia.ru/folklore/indexes.htm « » - http://www.folk.ru - http://www.unn.ru/folklore/folk.htm - http:// www.folk.phil.vsu.ru « » - http://ulfolk.ru « » - http://www.novgorod.ru/read/information/cultutre/folklore . http://www.unn.ru/folklore/folk.htm «» - http://e-project.redu.ru/virtual/varzuga/index.htm 12. - - , . ... Anropu: AorI.,{uaHona T.8., ...

Еще в разделе: (Показать все результаты (>2) - practice.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Moskovsky Alexander . ... Rogov Alexander . Modeling the reaction of hydrolysis of peptide bonds by trypsin by using quntum mechanical - molecular mechanical methods . ... Title: "Modeling Spectra of Molecular Clusters by Quantum Chemistry and Molecular Dynamics Methods" . ... Title: "Development of the Combined Quantum Mechanical - Molecular Mechanical Methods" . ... Title: "Modeling mechanisms of enzymatic hydrolysis reactions by the combined quantum mechanical - molecular mechanical methods" . ...

Еще в разделе: (Показать все результаты (>7) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

Magnetism Department MSU . ... Education . ... Process of education on magnetism division . ... Different courses on classical theory of magnetic phenomena and on actual problems of modern theory of magnetism are read on magnetism division. ... Students of magnetism division do practical work on the 8th term with more then 50 students from other divisions each year. ... Physics of semiconductors division . ... oblig. – alt. ... Alexander Shaligin, associate prof. assessment . ... oblig. 519, 505 . ...

Еще в разделе: (Показать все результаты (>19) - magn.phys.msu.ru/ )

• Information for PhD students
• Полезные ссылки
• Сотрудники кафедры магнетизма: Родионова Валекрия Викторовна

... 5-th All-Russian Conference . ... 12.00 - 14.25 Epitaxy of III-N materials . 12.00 - 12.15 III-N LEDs ON SiC SUBSTRATES. ... 12.15 - 12.30 EFFECT OF PARASITIC CHEMISTRY IN AlGaN MOVPE . A.V. Lobanova, E.V. Yakovlev, R.A Talalaev . 12.30 - 12.45 NON-POLAR a-(In)GaN HETEROSTRUCTURES . ... 16.00 - 16.15 InGaN QW WITH HIGH PHOTOLUMINESCENCE EFFICIENCY IN THE 490-630 nm RANGE, GROWN BY MBE PA ON с-Al 2 O 3 . ... Expirience of utilization D-180 (VEECO) setup for growth InGaN/GaN LED structures . ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

• 5-th All-Russian Conference "Nitrides of gallium, indium and aluminum:

МГУ имени М.В.Ломоносова Русская версия . ... Section ?Psychology? ... 29 Feb 2016 . ... 15 Apr 2016 . ... Chair Yury P. Zinchenko, professor, Dean of the Faculty of Psychology MSU . ... Chair Yury P. Zinchenko, Dean of the Faculty of Psychology MSU, academician RAE . ... A.G.Asmolov chair of the department of Personal Psychology, academician RAE; . ... B.S.Bratus chair of the department of General Psychology, corresponding member RAE; . ... Actual problems of sport psychology and healthy lifestyle. ...

Еще в разделе: (Показать все результаты (>17) - conf.msu.ru/ )

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...