... А.А. Данилова . ... Мониторинг СМИ . ... Библиотека : Публикации сотрудников кафедры : А.А. Данилова . Косово 1999, или об одном приеме манипулирования сознанием в СМИ . Автор Данилова А.А. Nov 21, 2007, 12:31 . ... Один из самых примечательных способов воздействия на сознание в СМИ - прием, который мы назовем персонализацией-овеществлением. ... Serb troops have continued attacks on unarmed men, women and children [5] ( англ .) ... Ни в одном выпуске еженедельника Newsweek за 1999 г . ...
МИЗОТИН Максим Михайлович старший преподаватель кандидат физ.-матем.наук: 2009 МГУ контакты: mizotin@cs.msu.su СЕМИНАРЫ: Обыкновенные дифференциальные уравнения 3-4 семестры, 2 курс Уравнения математической физики 5 семестр, 3 курс, 2 поток НАУЧНЫЕ ИНТЕРЕСЫ: математические методы обработки изображений методы обработки и анализа экспериментальных данных методы регуляризации математическое моделирование ПУБЛИКАЦИИ: A. S. Krylov, M. M. Mizotin. ... 22, No. 6, 2011, pp. ... Inorganic Materials, 2009, Vol. ...
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/pap/txt/mizotin.doc -- 33.5 Кб -- 13.12.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/pap/txt/mizotin.doc -- 33.5 Кб -- 13.12.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/pap/txt/mizotin.doc -- 33.5 Кб -- 13.12.2011 Похожие документы
... Сайт физического факультета . Неофициальный студенческий сайт факультета . ... Сайт библиотеки физического факультета . Список online изданий с доступом через физический факультет (в том числе SCOPUS, elibrary, Springer и др.) ... Lightwave Russian Edition 2003 . Lightwave Russian Edition 2004 . Lightwave Russian Edition 2005 . Lightwave Russian Edition 2006 . Lightwave Russian Edition 2007 . Lightwave Russian Edition 2008 . ...
... Составители и соредакторы электронного издания книги Ф.Д. Крюкова ' Над обрывом. Очерки и статьи последних лет жизни: 1917-1919 ' уведомляют читателя, что первоначальный вариант книги, который по инициативе А.Г. Макарова готовился в течение первой половины 2009 года, по не зависящим от нас причинам был сдан в печать и вышел из нее в неудовлетворительном виде под названием ' Обвал. Очерки смуты 1917 года глазами русского писателя '. М. 2009. ...
e-mail: lbronzino@gmail.com) , , " ", , " ", , , personal knowledge, tacit knowledge, "knowledge archaeology", subjectivity, "tacit knowledge", social cognition, methodology " " . ... According to M. Foucault, the "archive creation" may emerge as the missing element which can make up for the model of social cognition in which tacit knowledge will be expressed whereas Foucault integrates different practice patterns first and foremost, knowledge and power to create "knowledge archaeology". ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2012/2/08.pdf -- 130.1 Кб -- 03.11.2012
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2012/2/08.pdf -- 130.1 Кб -- 12.01.2015 Похожие документы
... О факультете | ... Структура факультета . ... Ладомир, М., 2001. ... Ладомир, М., 2004. ... М.: Ладомир, 2013. ... М.: Ладомир, 2014. Теория телевидения. ... Ладомир, М., 2015. Что такое телевидение? ... 4, 2014: http://kinoart.ru/archive/2014/04/chto-takoe-televidenie-versiya-otveta . Феномен телевидения, или какую передачу ведет Бернард Шоу? ... 5, 6, 2014. ... 2, 2014: http://journalist-virt.ru/files/2211/jsk214.pdf . ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... Chair of Computer Methods of Physics . ... Create new account (active tab) . ... Spaces are allowed; punctuation is not allowed except for periods, hyphens, apostrophes, and underscores. E-mail address * . ... The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...
... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... The Dynamic Characteristics of GPS Time Series and their Relation to the Seismotectonic Specific Features of a Region V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, Russia e mail: vszakharov@yandex.ru Received October 23, 2012 Abstract--The noise component in the time series of Earth surface displacements that were obtained with the Global Positioning System (GPS) is analyzed for 19 points. ... These facts affect the values of the investigated fractal characteristics. ...
[
Текст
]
Ссылки http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_2_eng.pdf -- 380.5 Кб -- 18.10.2013 Похожие документы
... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc -- 37.0 Кб -- 02.04.2012 Похожие документы
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Вакансии . ... Информация о компании: AB InBev . SUN InBev , OJSC - second-biggest brewer in Russia - part of world's leading brewer Anheuser-Busch InBev - is now looking for Campus Ambassadors in leading universities of Russia. ... Attract students to the AB InBev website to encourage on-line applications for the Global Management Trainee (GMT) program at www.ab-inbev.com/ownyourfuture . ...
... For the case of the circular trajectory, two families of exact solutions are obtained. ... These exact solutions allow us to obtain approximate solutions for the case of an elliptic trajectory of the waist. ... We also check the condition of keeping contact with the waist during twirling. ... Main relations We assume that the center O of a gymnast's waist moves in time according to the elliptic law x = a sin t, y = b cos t with the amplitudes a, b and the excitation frequency > 0, Fig. ...
[
Текст
]
Ссылки http://belyakov.imec.msu.ru/papers/Belyakov_Seyranian_6pages2011.pdf -- 2709.9 Кб -- 30.07.2011 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...