... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...
Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...
Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Department of Electrical and Computer Engineering, University of Toronto, 10 King's College Road, Toronto, Ontario, Canada M5S 3G4 (Received 14 October 2003; published 20 May 2004) We consider the interaction and stability of gap solitons in a one-dimensional, resonant, photonic crystal with a defect state produced by a linear localized mode, or by an incoherent pump. ... This is consistent with the physical meaning of the linear localized mode. ... Phys. Rev. Lett. ... Lett. ... Phys. Lett. ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
Семинар по социофизике . ... 22 сентября 2015 (вторник) . химический факультет МГУ, ауд. 337, Начало в 17.30 . ... Аннотация доклада . Презентация доклада - 1 . ... Информация о конференции "Социофизика и социоинженерия", . прошедшей в МГУ 6-11 июня 2015 г. 3. ... Вебдизайн: Copyright (C) И. Миняйлова и В. Миняйлов . Copyright (C) Химический факультет МГУ . ...
... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...
The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...
[
Текст
]
Ссылки http://www.fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015
[
Текст
]
Ссылки http://fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Main fields of study for the qualification and specialization . ... Bachelor Integrated Programme . ... Name of qualification (degree): BACHELOR . Field of study: 04.03.02 Materials Chemistry, Physics and Mechanics . Official length of full-time programme: 4 years . ... Name of qualification (degree): MASTER . ... Name of qualification (degree): . RESEARCHER, ACADEMIC RESEARCHER . Field of study: 02.00.01 Inorganic chemistry . ... Field of study: 02.00.21 Solid state chemistry . ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Programs . ... Faculty in the people . ... Two Master?s programs are carried out at the faculty ? ... In 2012 Lomonosov Moscow State University received the license to carry out educational activities with a specialization 074301 Producer?s Business . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... История лаборатории КГЭ . Лаборатория КГЭ сегодня . ... Информация для студентов 1-3 курсов . Информация для студентов 4 курса . ... Доступ к почтовым ящикам сотрудников из web-браузера . ... Различия между MailMan Standard Edition и Professional Edition . Почтовая система Endymion MailMan Standard Edition . Почтовая система Endymion MailMan Professional Edition . Почтовая система OpenWebMail . ... Лаборатория катализа и газовой электрохимии | ...
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.
Tatiana V. Salnikova . NAME: Tatiana V. Salnikova DATE OF BIRTH: June 28, 1960 CITIZENSHIP: Russian PROFESSIONAL AFFILIATION: Moscow State University, Department of Mathematics and Mechanics OFFICE ADDRESS: Tatiana V. Salnikova, Moscow State University Dept. of Maths. Mechanics, Theoretical Mechanics and Mechatronics Leninskie Gory Moscow 119992 Russia E-mail: tatsalni@mech.math.msu.su HOME ADDRESS: Tatiana V. Salnikova Litovski street 5/10, apt. ...