... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>12) - en.fbb.msu.ru/ )

• Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University
• BackgroundтАФ Faculty of Bioengineering and Bioinformatics, MSU

All PostScript files are compressed by gzip. ... Carrier transport and non-equilibrium phenomena in doped PbTe and related materials. - physica status solidi (a), 1993, 137 , 9-55 ( PostScript file ) ( PDF file ). ... Physics Reports, 1995, 257 , 85-131 ( PostScript file ) ( PDF file ). ... Phys., 1999, 86 , No 6, 3241-3246 ( PostScript file ) ( PDF file ). ... 1999, 14 , No 9, 852-856 ( PostScript file ) ( PDF file ). ... Вестник МГУ, Сер. физ., 2000, в.1, 39-43 ( PostScript file ) ( PDF file ). ...

Еще в разделе: (Показать все результаты (>22) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Tkaceva-14-JElectMat-PbTe.pdf

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>14) - erp.cmc.msu.ru/ )

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

Еще в разделе: (Показать все результаты (>2) - lib.sinp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>4) - www.students.chemport.ru/ )

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>27) - cdfe.sinp.msu.ru/ )

• Wave function of helium-like ions
• CDFE => Publications
• CDFE - Centre for Photonuclear Experiments Data - Home page

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

291. RELEC Mission: Relativistic ELECtron Precipitation and TLE Study on-board Small

292. Новости

293. TEPA 2012 | Thunderstorms and Elementary Particle Acceleration

294. www.99ru.ru - PRIJATELJ, KRUNO 1159

295. Animals | depozitariy

296. ВМиК - Online! : Новости - Издательство Springer предоставляет двухмесячный

297. Сигла - Поиск