... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
Список межфакультетских учебных курсов весеннего семестра 2015/2016 . Список межфакультетских учебных курсов весеннего семестра 2014/2015 . ... Настоящая страница содержит ссылки на сетевые ресурсы, посвященные межфакультетским учебным курсам МГУ. ... Видеозаписи лекций межфакультетских учебных курсов Интернет-телеканал МГУ ( http://tv.massmedia.msu.ru/#/catalog_2500 ). Межфакультетские учебные курсы МГУ раздел сайта биологического факультета МГУ ( http://www.bio.msu.ru/doc/index.php?ID=380 ). ...
... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... x25BA; New account . ... Select a country Afghanistan ?land Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua And Barbuda Argentina Armenia Aruba Australia Austria ... Belize Benin Bermuda Bhutan Bolivia, Plurinational State Of Bonaire, Sint Eustatius And Saba Bosnia And Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African ...
Cinquante-neuviХme annИe N° 3 Juillet-Septembre 2007 Revue internationale de droit comparИ Revue trimestrielle publiИe avec le concours du C.N.R.S. et sous les auspices du Centre franГais de droit comparИ R.I.D.C. 3-2007 LA RиFORM E DE LA PROCиDUR E CIVIL E RUSSE Dmitry Y. MALESHIN' Le nouvea u code de la procИdure civil e russe a ИtИ adoptИ en 2002. ... Des normes semblables existen t dans les codes de pays europИens, ainsi que dans leurs lИgislations gИnИrales. ...
... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Conference Venue . Conference Opening ceremony will take place on Tuesday, June 17 at 13:00 in the MSU Library Building . ... On other conference days registration will be possible in the room 706 of the 2-nd Educational Building. ...
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...
... В последней четверти XX в. проблематика истории революции стала вписываться консервативными историками в русло новой политической и новой социальной (локальной) истории. ... В работах историков заметно усилились идеи о континуитете, постепенном врастании старых социальных структур в новые и незавершенности социальных преобразований в Великобритании XIX в. В рамках концепции непрерывной национальной истории промышленная революция представала как часть длительного эволюционного процесса. ...
Биологический факультет МГУ имени М.В. Ломоносова . ... О нас (о кафедре) . ... Бакалавриат . ... Аспирантура . ... Перечень официальных тем кафедры . ... Список дипломных работ . Список диссертаций . ... Полезные ссылки . Ссылки на учреждения . Кафедра физиологии человека и животных МГУ 2013 . ...
... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/bmc_genom_2013.pdf -- 1155.9 Кб -- 15.12.2013 Похожие документы
... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... ConfИrence donnИe par GИraud de La Pradelle le 2 mars 2015 par skype Ю des Иtudiants de l'UniversitИ d'Etat de Moscou Lomonossov : CollХge Universitaire FranГais, FacultИ de droit et Haute Ecole d'Administration Publique L'exposИ portera sur les juridictions internationales, la Cour pИnale internationale et les relais que doivent jouer les juridictions nationales. ... Tableau des juridictions Il y a d'abord des juridictions qui tranchent les litiges existant entre Etats. ... Qui peut la saisir ? ...
[
Текст
]
Ссылки http://anspa.msu.ru/linkpics/News/G.deLaPradelle%20Texte%20revu%20.doc -- 48.0 Кб -- 22.04.2015 Похожие документы