... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
... Геология >> Геоэкология | ... Эколого-геологические условия Шанучского месторождения исследованы комплексно с привлечением методов различных наук о Земле, необходимых для получения той или иной эколого-геологической информации, а также метода эколого-геологического картирования (Теория и методология , 1997; Экологические функции , 2000 и др.) ... Схема расположения точек опробования компонентов среды в ходе полевых работ на Шанучском кобальт-медно-никелевом месторождении в 2003-2005 гг. ...
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...
MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
Influence of Hydrogen Bonding on the Properties of Water Molecules Adsorbed in Zeolite Frameworks A. V. LARIN, 1 2 1,2 D. N. TRUBNIKOV,1 D. P. VERCAUTEREN 2* Department of Chemistry, Moscow State University, Leninskie ... Belgium Received 3 May 2002; accepted 16 September 2002 DOI 10.1002/qua.10496 ABSTRACT: Three hydrated aluminosilicate frameworks-- LiABW , NaNAT, and BaEDI--are partly optimized with the periodic HartreeFock CRYSTAL95 code ... H atom. ...
Problems for Ultrahyperbolic Equations in Half-Space Prof. Dmitry P. Kostomarov Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Pontryagin Anniversary Conference June 1722, 2008 , Moscow, Russia Section Differential Equations Subsection Partial Differential Equations Prof. D.P. Kostomarov (CMC MSU) Problems for Ultrahyperbolic Equations June 22, ... June 22, 2008 (2.13) Problems for Ultrahyperbolic Equations 16 / 23 2.2. ...
[
Текст
]
Ссылки http://ani.cs.msu.su/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008
[
Текст
]
Ссылки http://ani.cmc.msu.ru/files/kostomarov-pontryagin2008.pdf -- 414.5 Кб -- 22.06.2008 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
МЕЖФАЗНЫЕ ВЗАИМОДЕЙСТВИЯ В СТОЧНЫХ ВОДАХ ОЧИСТНЫХ СООРУЖЕНИЙ . ... выпущено облако мелких частиц, сосредоточенных в При заданном начальном распределении частиц и скорости выпуска загрязнителей предполагается построить изолинии плотности смеси, поле скоростей смеси, что позволит прогнозировать концентрацию загрязняющих веществ в реке при фиксированной схеме течения и заданном сбросе загрязнителей и осуществить контроль за ходом технологического процесса на станции очистных сооружений. ...
... 28 октября 2011 года на 81-м году жизни скоропостижно скончался выдающийся ученый, основатель ведущей научной школы, профессор кафедры физики атомного ядра и квантовой теории столкновений физического факультета МГУ, главный научный сотрудник НИИЯФ МГУ, лауреат Ломоносовской премии Балашов Всеволод Вячеславович . ... Студенческий научный семинар кафедры физики атомного ядра и квантовой теории столкновений (312, 412 и 512 группы) проводится по средам еженедельно в 17:10, 19 корпус НИИЯФ МГУ, ауд. ...
Prehistoric Contacts between Hittite and Luvian: The Case of Reflexive Pronouns* Ilya Yakubovich University of Chicago The origin of the Hittite reflexive clitic = za represents an unsolved problem in Anatolian and Indo-European Studies. ... Hittite = za owes its existence to the paradigmatic generalization of the borrowed Luvian 2/3sg. reflexive clitic *=ti/*=di while the Luvian form must be derived from the Indo-Hittite dative clitic *= toi `to thee'. ... Hittite borrows Luvian *=ti/=*di. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf -- 316.0 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf -- 316.0 Кб -- 30.04.2010 Похожие документы
Виртуальный музей истории Московского университета - к 250-летию МГУ им. М.В. Ломоносова А.Ю. Андреев, Вл.В. Воеводин, Д.А. Никитенко Московский Государственный Университет им. М.В. Ломоносова г. Москва При подготовке к 250-летнему юбилею МГУ стоит задача обобщить его исторический опыт, показать вклад университета не только в историю отечественного высшего образования, но в развитие русской культуры и общественной жизни в целом. ...
Spes_innov_06_2007.qxd 10.07.2007 17:35 Page 1 Vivat academia! , . ... Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л Ё, лЁ 3D . ... лЁ , , Spes_innov_06_2007.qxd 10.07.2007 17:38 Page 3 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 3 Ё. , . ... Spes_innov_06_2007.qxd 10.07.2007 17:41 Page 6 6 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л л Ё 2007 . ...
[
Текст
]
Ссылки http://www.inpro.msu.ru/files/docs/Spes_innov_06_2007.pdf -- 2368.3 Кб -- 04.10.2007
[
Текст
]
Ссылки http://inpro.msu.ru/files/docs/Spes_innov_06_2007.pdf -- 2368.3 Кб -- 04.10.2007 Похожие документы
General Utility Lattice Program Version 4.0 Julian D. Gale Nanochemistry Research Institute, Department of Chemistry, Curtin University, P.O. Box U1987, Perth, WA 6845, Australia email: gulp@ivec.org 1 Chapter 1 Introduction & background The General Utility Lattice Program (GULP) is designed to perform a variety of tasks based on force field methods. The original code was written to facilitate the fitting of interatomic potentials to both energy surfaces and empirical data. However, it has expanded now to
... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...
... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...
УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016 Похожие документы