... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
... Начало www.99ru.ru Первые и прижизненные издания Естествознание 2507 . ... Введите код товара из каталога. автор RAWLS, John (1921 - 2002) . A Theory of Justice первое издание . ... 2507 . RAWLS, John (1921 - 2002) . ... New York Review of Books, 02/24/1972 "I think that this book is the most substantial and interesting contribution to moral philosophy since the war, at least if one thinks only of works written in English. ... BOOK IS FINE WITHOUT ANY MARKS TO THE BINDING OR THE TEXT. ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
General Information . News . Organizing Committee . ... Registered participants . Symposium expenses . ... Presentation information . ... Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . ... Participants interested in ordering a taxi to travel from airports to MSU and back are welcome to send appropriate requests to the Organizing Committee by using the email address in the Contact Information. ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... Leading Researcher . Senior Researcher . ... Research Associate . 7(495)939-4372 (4) . ... The Laboratory performs research activity in the following directions: . Quantum optics of biphoton fields . Quantum optics of pulsed fields . ... Terahertz generation and detection . ... Quantum photometry in the terahertz range . ... 2003 2016 Department of Quantum Electronics . ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы
... Актуальная информация . ... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ...