Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... Plants . ... The study of structural and functional plant systems diversity at different levels (cell-to-biocenotic) will reduce the risk of violating the stability of the living systems in Russian Federation. Russian Federation plays a key role in the preservation and use of raw Arctic potential. The highest spore plants, as an essential component of plant communities in northern Holarctic are involved in the settlement of naked substrates, preservation of permafrost and bogging. ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Научные семинары . ... расписание семинаров . семинар 1 . ... Отчет о семинаре || ... This talk will focus on one of the emerging technology for solar light conversion into electricity; the dye-sensitized solar cell. ... The present lecture will give a general background to the solar energy field with a focus on dye-sensitized solar cells. ... С докладом Dye-sensitized Solar Cells Materials and Interfaces выступил профессор Lars Kloo из Королевского технологического института г. Стокгольма. ...
... История медицинского образования в МГУ . ... ;legends of cardiology and leading cardiologists on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of...
Cell. ... 2012) 69:17871797 DOI 10.1007/s00018-011-0895-z Cellular and Molecular Life Sciences REVIEW Cytochrome c: the Achilles' heel in apoptosis A. V. Kulikov · E. S. Shilov · I. A. Mufazalov · V. Gogvadze · S. A. Nedospasov · B. Zhivotovsky Received: 5 September 2011 / Revised: 30 October 2011 / Accepted: 22 November 2011 / Published online: 17 December 2011 с Springer Basel AG 2012 Abstract Cytochrome c is a well-known ... How is cytochrome c released from mitochondria? ...
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
... Начало www.99ru.ru Первые и прижизненные издания Естествознание 2507 . ... Введите код товара из каталога. автор RAWLS, John (1921 - 2002) . A Theory of Justice первое издание . ... 2507 . RAWLS, John (1921 - 2002) . ... New York Review of Books, 02/24/1972 "I think that this book is the most substantial and interesting contribution to moral philosophy since the war, at least if one thinks only of works written in English. ... BOOK IS FINE WITHOUT ANY MARKS TO THE BINDING OR THE TEXT. ...
General Information . News . Organizing Committee . ... Registered participants . Symposium expenses . ... Presentation information . ... Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . ... Participants interested in ordering a taxi to travel from airports to MSU and back are welcome to send appropriate requests to the Organizing Committee by using the email address in the Contact Information. ...
... СУНЦ МГУ . ... Краткая информация . ... Материалы экзаменов 1-го тура прошлых лет . ... Кафедры . ... Сотрудники . ... Кафедра химии . ... Сезонные школы СУНЦ МГУ . ... Олимпиадные сборы СУНЦ МГУ . Интернет-ресурсы СУНЦ МГУ . ... Заочная школа СУНЦ МГУ . ... Главная Подразделения Кафедры Кафедра химии Chemistry Chair . Chemistry chair of AESC MSU was founded at 13 November 1989 by professor of MSU Chemistry department Yu. ... Natalia Igorevna Morozova, docent, PhD (Chem.) ... Chemistry Chair . ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
Локальная компьютерная сеть . студентов . механико-математического . факультета МГУ . ... Последнее объявление: 05.12.2005 Программа стажировок для студентов . ... Автор новости: Bot . ... естественных факультетов МГУ им. М.В. Ломоносова . ... Автоматическое сообщение: Добавлен файл (любой) new_not_checked_other_lyuboi_10.rar - Дипломы, курсовые готовые и на заказ студентам!! ... Лекции по квантовой механике для студентов-математиков (обновил: Shema) . ... о сети | ...